Grant Recipients and Their Research
Grant Awards
Nicholas Cox
Identifying Provenance of Uranium-Bearing Minerals in Jacobsville Sandstone of the Eastern Upper Peninsula of Michigan
The Jacobsville Sandstone is a common sedimentary rock unit in the Upper Peninsula of Michigan in the Lake Superior Basin. Provenance refers to the origin of the sediments which comprise the sedimentary unit, and provenance rocks are the units which the sediments originally eroded from. Though there have been studies into the Jacobsvilles provenance before these studies have focused on the Western Upper Peninsula, while the Eastern Upper Peninsula is far less well understood. Also not clearly understood is the provenance of Uranium trace elements found in the Jacobsville Sandstone throughout the Upper Peninsula. This research project aims to collect samples of the provenance rocks of the Jacobsville Sandstone which can be found in Gogebic County, and are part of the Gogebic Iron Range and Marquette Supergroup, and analyze them in thin section to determine their relation to Jacobsville Sandstone samples collected in the Eastern UP, as well as attempt to identify the source of uranium.
Joshua Lubben
The Effectiveness of Rice as a Cost-Effective Soil Bacteria Capture Method
Soil is an important habitat for organisms witch provide many important functions to natural systems. Multiple studies showing that soil fungi help plants access and take up vital nutrients (Halifu et al, 2019; Chen, et al. 2020; Kang, et al. 2021). These natural functions have been found to transfer over to agricultural systems as well. Wissuwa and other researchers (2020) found that a microbial fungus was found to help rice plants access phosphorus in deprived soils. Pepper plants that were connected to a large network of fungus were found to have a heightened drought tolerance (Marasco, et al. 2012). However, for many decades conventional agricultural practices have been unsustainable. These practices rely heavily on artificial manipulation of the environment to keep the soil productive. The common practice of tilling disturbs soil structure and causes microbial communities to change in population structure (Smith, et al. 2016). Growing the same crop year after year depletes the soil of nutrients, requiring the addition of fertilizers. Growing the same crops also causes a larger population of species that feed off the crop, so farmers need to use pesticides to control pest populations. In the past few years, the idea of organic agriculture has grown in popularity. This method of agriculture looks to rely less on the conventional ways of agriculture, and more on natural proses. As organic agriculture relies less on tillage and chemicals it looks to nature systems for inspiration. That may be plant-based fertilizers, companion planting or many other methods.
One important practice of organic agriculture is the use or beneficial organisms commonly referred to as beneficial. Beneficial provide many functions such as population by bees and butterflies and predation of pests by ground beetles and lady bugs. One subset of beneficials is easily overlooked, microscopic soil organisms . Due to degraded and altered soils soil life can be in a poor condition. Exceptionally if the soil has been under conventional agricultural practices. Tillage disrupts soil structure and causes a change in population of soil microbes (Smith, et al. 2016). So it may be necessary for soil microbes to be introduced to the soil to ether change diversity or reintroduce vital species. It is possible to buy soil microbial starters but there is no guarantee that those microbes are naturalized to a systems natural prosses. The cost of buying these starters may be inefficient for small producers and individuals gardeners. One possibility is using microbes from a local location. There native and naturalized microbes will be used to natural prosses in the environment. Reddy (2011) described a processes to capture local microbes from an undisturbed habitat. The captured microbes can then be transported and spread upon organic agricultural systems. Reddys processes involves leaving a box of boiled white rice in a local field or forest where the local microbes move in to feed upon the rice (2011). This study will use this method of soil microbe capture and determine how this method does in capturing the true diversity within the soil biome. The second objective of this study is if there is any difference between using white rice and a native species of rice. To evaluate these questions four plots will be set up in the fields and open areas of 勛圖厙s Hunt Creek Field Station. Each plot will consist of three boxes set upon bare soil. The boxes have thin bottoms with holes drilled in them to give soil microbes access to the inside. Each plot will receive one box of boiled white rice, one box of boiled wild rice and one box of clean potting soil, which will act as a control. A soil sample will be taken from each plot. The boxes will be left in the field for five days. At the end of the time, each box will have samples taken out of them. The samples will be run using the 16s Metagenomics test. This test was used by multiple other studies to gather similar data (Valverde et all, 2016; Sumerta et all, 2020). This will give the percentages and number of species present in each sample. The test from the boxes will be compared to the test results from the soil samples taken. The main information that will be looked for, is how closely a box represents its corresponding soil sample and is there any statistically significant difference in the values between the boxes and the natural soil among the plots.
Chase Jannetta
Design and Experimentation of a High Accuracy Vision-Based Adjustable Projectile Launcher
Vision-based feedback is an ongoing field of research in robotics with many applications. Vision systems are used widely in applications such as self-driving cars, factory lines, and aerial analysis. Self-driving cars that use vision to detect pedestrians, traffic and make decisions based on the vision feedback are being developed (loi Zablocki,2022). Quadrotors that use vision to navigate are being researched and tested (Foehn,2022). The goal of our project is to develop the system needed to accomplish Task 7 of the RobotX Competition using vision-based feedback. Task 7 involves identifying the correct dock with the target, navigating to that dock, and launching a 2-inch diameter racquetball through a hole in the target (Robonation, Task 7- Find and Fling, 2022). To this end, a projectile launcher will be developed, capable of launching the four racquetballs provided. The launcher will be interfacing with Team AMOREs WAM-V, an unmanned surface vessel equipped with navigation and vision systems (Team AMORE, 2022). Code will be developed that allows the WAM-V to identify the required target via the onboard ZED 2i camera, and navigate to that target. As the ball is launched at the target, vision-based data will be collected using the camera, about the position of the ball as it either passes through the goal, or as it misses the target. This data will be used to adjust the onboard simulation controlling the launchers firing velocity and release angle, in order to increase its accuracy. Doing so, the more shots are fired, the more accurate the shooter will be.
Gabrielle Minier
The Effects Host Have on the Microbiome of Michigan Ticks
The objective of this research project is to see if there is any relationship between the last host of Michigan ticks and the bacteria in their microbiome.
Carrie Gregg
Presence of Taxoplasmosis within Felines and Canines in the Upper Peninsula Animal Shelters
Looking to see if Toxoplasmosis is prevalent in Sault Ste Marie within felines and canines at the animal shelter. Toxoplasmosis is an illness that comes from the Toxoplasma gondii parasite, also known as Crazy Cat Lady syndrome. This parasite has the ability to change the behavior of the intermediate hosts to be eaten by the definitive host. Toxoplasma gondii infects the Felidae family, because they produce a bunch of linoleic acid that is necessary for the parasite to fully mature and complete its life cycle. The parasite can enter the brain of a fetus if a pregnant woman is infected, and it can cause adverse effects for immune compromised individuals. Knowing the prevalence in our area will help to better manage risks to this parasite.
Kira Kohler
Comparing Cognitive Effects of Pharmaceutical Anxiety Medications with Holistic Alternatives
Pharmaceutical anxiolytics, while being decently effective, also come along with a plethora of neurological side effects such as lethargy, sedation, ataxia, and even seizures (Ballantyne and Ciribassi, 2014; Sargisson, 2014). The most notorious among these medications is Trazodone, a selective serotonin reuptake inhibitor (SSRI) which has been known to commonly cause stress on the cardiovascular system (Atli et al., 2019). Because Trazodone is an SSRI, patients that use this medication are also at risk of developing serotonin syndrome, which can be deadly in extreme cases (Boyer and Shannon, 2005). Due to the adverse effects that pharmaceutical anxiolytics can have on animals, many pet owners have been looking toward holistic alternatives to ease their pets anxiety, such as melatonin supplements. Adding melatonin supplements to an animals diet has been observed to reduce situational anxiety and even inhibit memory impairment (Lamtai et al., 2021).
Considering the fact that pharmaceutical medications have neurological side effects that are observable even to the untrained eye, there could be a possibility that the medication is doing more harm in more subtle ways that owners may not notice. The purpose of this study is to determine if these pharmaceutical anxiolytics do, in fact, hinder the cognitive processes of animals by comparing them to holistic Should these medications prove to alter the cognitive ability of the subject taking them, this could affect the overall treatment for anxiety in domestic pets. Other methods of treatment would need to be sought out to replace pharmaceutical anxiolytics for all animals. In order to test if a pharmaceutical anxiolytic, specifically Trazodone, has any effect on the cognitive processes of an animal, 18 Long-Evans rats will be divided into three groups of six subjects. One group will act as a control, another group will be administered Trazodone, and the last group will be administered melatonin supplements. Before each group is treated with these medications, baseline testing will be performed, wherein each rats working memory, spatial memory, and mental health will be assessed. A four-week treatment period will follow, and afterward the rats will be tested using the same methods as the baseline testing. Once the data has been compiled, it will be determined whether or not pharmaceutical anxiolytics negatively affect the cognitive processes of animals.
Naomi Astorga
Plant Tumor Cells Effects on Glycolysis
Summary: One of the hallmarks of cancer is an increase in glycolysis in the presence of oxygen (Jiang, 2017). This is known as the Warburg Effect. Though it is not fully understood, it is thought to result from mitochondrial dysfunction of the cancer cell. I would like to take a closer look at this effect using a novel model plant disease, termed crown gall. In this experiment, I will be inoculating soybean plants with Agrobacterium tumefaciens to induce the formation of crown gall tumors and quantifying a difference of the level of pyruvic acid between the uninoculated plants (control group) and the groups of inoculated plants with varying levels of inoculation. Introduction: Both plants and animal cells have mitochondria that work to produce energy for the cell. In the presence of oxygen, plants will undergo cellular respiration to acquire ATP, which is used for a multitude of cellular processes requiring energy. However, when oxygen is not available the cell will undergo glycolysis in the cytoplasm. Glycolysis is a much less efficient way to gain ATP as it only produces 2 ATP whereas cellular respiration occurs in the mitochondria, the powerhouse of the cell, and produces 30-32 ATP. The Warburg Effect, or Warburgs hypothesis, states that cancer cells choose aerobic glycolysis as [a] main mode of glucose metabolism instead of more efficient oxidative phosphorylation (Jiang, 2017). Cancer is the uncontrolled division of cells that form masses of tissue called tumors. Cancer cells also have dysfunctional mitochondria that causes the cell to rely on glycolysis that can be done in the cytoplasm outside of the mitochondria (Fadaka et al, 2017). Agrobacterium tumefaciens is a gram-negative bacteria found in soil that causes crown gall tumors at wound sites of the infected plants (Hooykaas et al, 1982). The bacterium enters the plant through wound sites and transforms the healthy plant cells into tumors (Lee et al, 2009). Soybean plants are a plant that take approximately 45-55 days to mature. They require warm soil to grow and grow best in daytime temperatures around 70簞F (21簞C). They are poor soil tolerant and require minimal space usage for potting and soil (McConnell, 2019). Pyruvate, or pyruvic acid, is produced by the final step of glycolysis and can be used to measure how much glycolysis is being undergone in a sample. Lactate Dehydrogenase (LDH)-based Spectrophotometric assay is the most common way to test pyruvate concentrations. It is a well-established assay compatible for taking these measurements from my samples. Importance: There could be a correlation between bacteria infecting an organism that causes tumors (cancerous) cells and the level of dysfunction of the mitochondria. This is important because of all the other possible implications and questions that follow afterward.
If there is an increase in glycolysis that correlates with the level of inoculation of the bacteria, further testing could be done to understand the correlation. Is there a correlation between the amount of bacteria inoculum and the amount of glycolysis? How do the glycolysis levels correspond (or dont) with the actual tumor formation? These are important questions for understanding when the cells metabolic transition occurs relative to the actual cancer (tumor) formation. Methods: There will be four groups of three plants each so all measurements will be done as a mean of the triplicate. A group of three plants will have no bacteria inoculation and will be used as a control. Other groups, all of three plants each, will be: single-wound inoculation, double-wound inoculation, and triple-wound inoculation. This will bring the total of plants tested to 12 which fits well on a 96-well plate used for spectrophotometry which will be used to measure the absorbance and calculate the pyruvate concentration. The soybean plants will be grown in the university greenhouse to ensure the most controlled environment possible, to increase repeatability and replicability of future experiments. Plants will be grown for 55 days to ensure they have reached maturity (McConnell, 2019). A small incision will be made along the stem of the plant and the wounds will be inoculated with the same relative number of bacteria cells of Agrobacterium tumefaciens, using an inoculating loop. Agrobacterium tumefaciens is a Biosafety Level 1 (BSL-1) organism, so it is compatible for safe use by student researchers. Additional incisions and inoculation will be done to create the varying groups (one wound, two wound, and three wounds). A visible gall tumor can be seen in 4 weeks, so plants will be monitored for 4 weeks to ensure the proper number of crown gall tumors have grown for each inoculated plant (Gonzalez-Mula et al, 2019). The pyruvate extraction procedure will be the modified procedure done by Zhu et al (2010) that was adapted from the original procedures from ODonell-Tormey et al (1987) and Lamprecht et al (1974). A standard curve of absorbance and pyruvate concentration will be created using known concentrations of pyruvate extract. The absorbance will be taken at 339 nm, LDH will be added, and the sample will be incubated at room temperature in the dark for 30 minutes before absorbance is taken again. The change of absorbance between these two measured absorbances will be used to calculate the pyruvate concentration for the standard curve. Extraction of LDH will be done by the blending of the soybean plants to homogenize them. Cells will be cultured and treated with extraction buffer, centrifuged, and put through a column to purify the LDH (Rivoal et al, 1991). The LDH assay will be repeated on the cells after purification treatment. Absorbance will be taken and used with the standard curve to calculate the pyruvate concentration (Zhu et al, 2010).
Emily McDonald
Conversations with Dogs: Does Talking to our Canine Companions Reduce Their Stress?
Humans and canines have lived together for thousands of years, but the bonds that once were simply companionship have become reliance on one another. The anatomical structure of a dogs face and the expressions they use have even been influenced by their relationships with humans by evolving to mimic those of their human counterparts (Smith and Valkenburgh 2020). These have been recognized, sometimes subconsciously, by humans in need when they interact with therapy dogs. The simple presence of canines has been shown to reduce human stress in situations varying from patients in emergency rooms (Kline, Fisher, et al. 2019) to overwhelmed college students (Fiocco and Hunse 2017). However, humans are not the only ones whose stress can be reduced from interactions with the other species.
A study conducted in the United States found that shelter dogs who were fostered overnight had decreased stress levels, based on behavioral characteristics and cortisol:creatinine ratios in the urine, when compared to nights they spent without human contact in the shelter (Gunter, Feuerbacher, et al. 2019). Another study found that petting dogs after they underwent a blood draw reduced the stress levels of the animal during a subsequent blood draw 20 minutes later (Hennessey, Williams, et al. 1998). Interactions such as these show that though an emphasis is placed on the emotional support humans receive from their canine companions, the dogs feel the benefits of the relationship, as well. Many studies have been conducted to discover the impact of our interactions with dogs, but most focus on the direct contact between the species, such as petting. Few to no studies have examined the impact of day-to-day vocalizations with canine companions. The objective of this study is to examine how human voice and conversation impacts the stress levels of dogs. The hypothesis is that human vocalizations will reduce the behavioral signs of stress in dogs as well as lower the urine cortisol:creatinine ratio. Methods A total of ten dogs will participate in the study, all of which will be from eastern Upper Peninsula animal shelters. A veterinarian will be on site while the research is being conducted to ensure the dogs remain healthy and handled correctly. Since staying in a kennel has been found to cause stress in dogs, this will serve as a natural stressor for the experiment (Hennessey, Williams, et al. 1998). After being kenneled for two hours, each dog will spend ten minutes interacting with a human. A baseline behavioral assessment will be recorded during initial interaction with the dog to compare to the final results. Salivation, panting, pacing, and vocalizing will be graded on a scale of 0-5, with zero signifying that the behavior is not present, and five signifying that the behavior is excessive. All of these behaviors have been recognized as visible signs of stress in canines (Almond, 2018). During the ten minutes on the first day, the dogs will be spoken to in a normal voice and petted. The same phrases to greet the dogs using their specific names, discussing the plan for the day, etc. will be used. After the ten minute interaction with vocalization, the dog will be walked outside to void their bladder, and a urine sample will be collected (free-catch using a collection cup). The sample will be labeled with the time of collection, date, name of the dog, and vocalization, and will be frozen until data analysis occurs. The same behaviors as before will again be observed and recorded after this procedure to determine if signs of stress decreased after the human interaction.
This process will be repeated for each participant on three separate days. To obtain a control, the human interaction will include no vocalization, and the same procedure will be used to record stress behaviors and collect the urine sample. However, on these days, the dog will not be spoken to at all. Interaction will be limited to human presence and direct contact (petting). This will also occur on three separate days, resulting in data from each dog for six days, three with vocalization, and three without. For urinalysis, the cortisol:creatinine ratio will be measured. Methods for this analysis were used in a study conducted to determine if this ratio is a valid measurement of increased stress in dogs. The study found that by measuring the amount of cortisol using an immunoassay kit and comparing that value to the amount of creatinine in the sample (determined by Jaffe reaction and spectrophotometry), the ratio was a valid indicator of stress in canines. Cortisol is a hormone that is released when canines are stressed. An increase in the cortisol present in urine correlates to an increase of feeling of stress in a dog. The creatinine content is used as a measure of urine concentration, which varies by animal, hydration, and other factors. By comparing cortisol levels to the measure of creatinine, the effects of concentration can be eliminated. Spectrophotometry, the measure of a solutions light absorption, will be used in this experiment to analyze the urine samples for both cortisol and creatinine (Part, Kiddie, et al. 2014). These values, as well as the values assigned based on stress behaviors will be compared for each individual dog for vocalized interactions versus interactions without vocalization. If the cortisol:creatinine ratio and stress behaviors with vocalization are lower than the values without vocalization, it can be determined that human speech and conversation lowers canine stress.
Jeremy Turnbow
The Spread of Bacterial Kidney Disease Through Common Bait Fish
Renibacterium salmoninarum (RS), the bacterium that causes Bacterial Kidney disease (BKD), has had a severe impact on Salmonid populations in the Great Lakes since as early as the 1950s. In the 1970s, BKD infected a large percentage of the Salmonid fish and caused an alarming number of mortalities. To combat this, hatcheries test for BKD in eggs due to its ability to transfer vertically. Since then, BKD has become less prevalent, but it is still an endemic threat to salmonids in the Great Lakes. After hearing about BKD, I wondered if it was possible for BKD to transfer horizontally between species or possibly been introduced to the Great Lakes by other live baitfish via fishing activities. In particular to my project, I want to see if common bait fish, such as the Golden Shiner, are susceptible to BKD and if they are able to transfer the disease back to Salmonids. I will collect bait fish from a local bait shop and they will be placed into 3 tanks. Tank 1 will contain 10 fish and will not be inoculated with RS. Tank 2 will contain 10 fish that are exposed to RS through the water. Tank 3 will contain 10 fish that have been individually inoculated with RS via injection. The fish will be acclimated and then fed daily. Tanks will have a filter to ensure they have ample dissolved oxygen. Under these conditions, the fish will thrive for 4-5 weeks before being euthanized and tested for BKD in the kidney tissue with ELISA kits. If these fish test positive, we will then inoculate 5 more Golden Shiners and have them live in the same tank with 5 Atlantic Salmon juveniles to see if bait fish can transfer BKD horizontally. If this happens, this means that bait fish across the Great Lakes can be damaging to Salmonid populations if infected fish are sold to anglers.
Sophie Paquin
A Study of Nesting Preference and Effectiveness of Natural Reeds vs Reusable Wood Trays in Managed Spring Mason Bees, Osmia spp
With the ever-growing awareness of the decline in pollinator species in the United States, which is primarily due to habitat loss but also partially linked to pesticide use and disease spread by the European Honey Bee, a grassroots movement to protect native bees has arisen in the form of providing nesting sites for native pollinators. These man-made nesting sites are commonly known as bee hotels, or artificial domiciles, and they are designed to encourage nesting and pollination by native pollinators. However, as the trend has become more popular and the need more urgent, debates have arisen within the native bee raising community over the best way to go about rearing native bees. On the forefront of the debate is which of the two popular commercial nesting materials, natural reeds or reusable wood trays, are more effective in propagating new bees. While many observations and opinions can be found on online bee forums, few scientific studies have been conducted addressing the question, with none focusing specifically on spring mason bees, Osmia spp., the most popular native solitary bee reared in the United States for fruit tree pollination.
The gap in the literature is wide, and findings from this study could be consequential to conservation and agriculture alike as the Save the Bee campaign broadens to include more than just honey bees. My senior research idea examines two hypotheses: Natural reeds are more effective than reusable wood trays in raising spring mason bees if effective is defined as producing the highest number of viable mason bee cocoons. Given the option, spring mason bees will show a preference toward natural reeds over reusable wood trays; they will produce significantly more cocoons in reeds than trays when both options are presented to the same bees equally. To compare the effectiveness of different nesting materials commonly used by native beekeepers (namely reeds and trays) I will observe installed spring mason bees, Osmia spp.,and compare the number of viable bee cocoons collected from each nesting type at the end of an active season. On each of the two locations, three groups will be established: Group A: Only Reeds Group B: Only Trays Group C: Reeds and Trays On Site 1, Spring Mason Bee colonies will be established on a property west of Gregory Gardens at 3290 E 9 Mile Road in Sault Ste. Marie, MI. Groups will be placed no less than 200 yards from one another to prevent interaction between colonies. In the spring and summer, the property will have adequate food sources for the installed bees, including crab apple trees, clover, and miscellaneous wildflowers. There is also a creek for a water/mud source. The location for Site 2 is located at 3588 S Riverside Dr, Sault Ste. Marie, MI near the Saint Marys River. On both sites, additional mason bee mud will also be provided near the domiciles, as mason bees rely on clayey mud to construct brood cells. InvataBee Mason Bee Attractant will also be sprayed on each domicile at the period of installation and when nesting materials are added; InvataBee Mason Bee Attractant is a USDA-patented formula designed to mimic natural pheromones to encourage nesting.
In addition, bird guards will be placed on all domiciles to prevent predation of mason bee larvae. In the fall, cocoons will be harvested, counted, and sorted by site, colony, and nesting material type collected from, for a total of eight bee bags labeled 1A, 1B, 1CR, 1CT, 2A, 2B, 2CR, and 2CT, with the initial number indicating whether cocoons were collected from Site 1 or Site 2 and the following letters indicating colony and nesting material collected from. After the cocoons have been counted by me on-site, they will be sent by mail to Crown Bees Headquarters in Woodinville, WA, to be recounted, tested for viability, and ultimately redistributed to native beekeepers throughout the nation in the following season. Crown Bees will send me a professional breakdown of the number of viable bee cocoons found in each bag, which may differ from the total number of cocoons found in each colony and nesting material due to disease, harvesting errors, and other factors. Bee Bag Grouping Key 1A: Cocoons harvested from the Site 1 Only Reed group 1B: Cocoons harvested from the Site 1 Only Tray Group 1CR: Cocoons harvested from the Site 1 Reeds and Trays group, taken from the Reeds 1CT: Cocoons harvested from the Site 1 Reeds and Trays group, taken from the trays 2A: Cocoons harvested from the Site 2 Only Reed group 2B: Cocoons harvested from the Site 2 Only Tray Group 2CR: Cocoons harvested from the Site 2 Reeds and Trays group, taken from the Reeds 2CT: Cocoons harvested from the Site 2 Reeds and Trays group, taken from the trays A statistical analysis test will be used to determine whether the difference in viable bee cocoon numbers is significant (in other words, if variability in cocoon count is due to chance or nesting material type). If the difference is found to be significant, it may indicate a more effective nesting material, effective indicating the successful propagation of mason bees as shown by the higher number of bee cocoons. The secondary hypothesis of this study examines bee preference for nesting material. To determine bee preference, special attention will be paid to the C groups, which contain both reed and tray nesting options, during weekly observations. I will note and document bee activity, indicating which nesting material bees are investigating the most and which nesting material appears to be filled the quickest, particularly at the beginning of the season. In addition, statistical analysis tests will compare cocoon counts in 1CR vs. 1CT, 2CR vs. 2CT, 1CR vs. 2CR, and 1CT vs. 2CT to examine whether preference can be deciphered from cocoon count. Because preference does not necessarily equate to effectiveness level, only the number of cocoons will be considered in statistical tests regarding preference. Viability of cocoons will not be considered.
Samuel Mitchell
Relations Between Season and Discharge from a Hydroelectric Reservoir on the Density and Transport Distance of Zooplankton in the Saint Joseph River in Berrien County
Rivers, by their very nature, are a constantly changing ecosystem. River processes can be further complicated if a reservoir is built on the river, with variable discharge entering the river system downstream. For example, water flowing through a reservoir, and downstream from the dam, can be variable by season (e.g., wetter versus dryer months) and storm events, which could increase the outflow of water to a river from a dam. These dynamics can subsequently impact the ecosystem and alter the composition and abundance of certain organisms in a river network. One such important organism group that can be affected by a dam and variable water flow are zooplankton. Zooplankton are part of the food chain of aquatic ecosystems they provide an important source of food for other larger organisms such as fish and can affect water quality. Zooplankton communities can be drastically affected in rivers from seasonal dynamics mitigated through upstream dams and reservoirs (Havel et al. 2009). Although zooplankton are commonly studied in slower moving lakes, zooplankton can also inhabit river systems and be transported downstream to other aquatic ecosystems (Portinho et al. 2016). Some zooplankton species also prefer to inhabit different depths of rivers and can change their distribution day versus night. However, zooplankton remain understudied in rivers versus lake ecosystems, and more information is needed to better understand how seasonal and other environmental factors (such as storms, which are increasing in frequency and intensity in many regions because of climate change) affect zooplankton abundance and transport downstream from reservoirs. My project aims to study the effects of hydroelectric dams on the density and transport of zooplankton in the Saint Joe River in Berrien County.
The effects of storms are also an area of interest for the study as they can increase water discharge, thereby affecting the quantity and composition of zooplankton downstream from what is present in the reservoir. This river also enters into Lake Michigan, and so the amount of zooplankton entering Lake Michigan from an upstream reservoir can be quantified. Samples will be collected from the Saint Joseph River using a 60 繕m mesh size, 50 cm diameter, zooplankton tow net. Zooplankton will be collected by a horizontal tow in three locations in the river at each sampling event, the tow net will be administered horizontally from a kayak for 5 minutes to allow enough volume of water to enter to capture enough zooplankton to quantify. These three river locations will be: just downstream of the reservoir, approximately equal distance between the reservoir and the mouth of Lake Michigan, and close to the mouth of Lake Michigan. In the reservoir (Lake Chapin), a vertical net tow will collect zooplankton in a deep section of the reservoir; these vertical tows will collect zooplankton from 1 m from the bottom to the surface. Samples will be collected once a month from May through August and before and after storm events (3 paired before and after storm events will targeted to be collected). After the samples are collected, the zooplankton will be preserved using 99% isopropyl alcohol, and will be analyzed using a dissecting microscope in the 勛圖厙 labs to identify each specimen to the genus level. Specimens will also be measured, and density and biomass will be calculated for each sample (Bum et al. 1996).
Matthew Hanson
Effect of Poly-D-Lysine Coating on mRNA Transfection Efficiency in HEK293T Cell Cultures
The ability to make a cell produce a foreign protein (from another organism) is an important tool of cell and molecular biology research with many applications in medicine. In a general sense, some form of nucleic acid, DNA or RNA, needs to enter the cell to provide the genetic code for the foreign protein to be produced. This strategy for protein production in a test tube is the basis for protein subunit vaccines and recombinant protein drugs such as insulin. There are various ways to cause a cell to produce a foreign protein. When not using a virus, this process is known as transfection. One way to accomplish this is with mRNA and various delivery systems. Just as the Pfizer/Moderna mRNA vaccines cause your human cells to produce the coronavirus spike protein, this technology can be used to cause cultures of living cells to produce any protein for which the genetic sequence is known (with limitations.) Compared to cultures of bacteria or yeast, mammalian cell cultures require very specific conditions to survive. This includes: a specific liquid nutrient medium, temperature, gas mixture, and many require a surface to grow upon. The most common material that tissue culture vessels are made of is polystyrene, a plastic. Naturally water repelling, the surface of polystyrene tissue culture plates are treated with oxygen plasma to modify the surface. This results in a negatively charged more water loving surface that allows many cell types to adhere. Some cells require, and others may benefit from, the addition of an extracellular-matrix mimicking coating. This is because cells in mammals are usually surrounded by a matrix of fibers, like collagen. Coatings available include: the polymer poly-lysine and the various animal proteins such as collagen, laminin, and fibronectin. Developed to more closely mimic the extracellular environment of a living organism, the coatings increase the ability of some cell types to adhere to the vessel (Corning, product manual). The aim of this experiment is to assess the effect that a poly-D-lysine coating has on the efficiency of mRNA transfection in HEK293T (human embryonic kidney) cells. In 1977 this cell line was produced from human embryonic kidney tissue, and has been a common cell line for production of recombinant proteins and human viruses. The hypothesis is that the difference the coating presents to the extracellular environment could cause a difference in the development of the cellular membrane. The cellular membrane is the barrier that must be overcome in order for the mRNA to enter the cell and be translated to make a protein.
Therefore, differences in membrane composition or structure could cause differences in the ability of mRNA to enter the cell and be translated into protein. The percentage of cells that the mRNA successfully enters and produces the protein is known as transfection efficiency. The foreign protein being chosen is green fluorescent protein. Under UV light, green fluorescent protein emits a green light. This unique property of fluorescent proteins allows for easy identification, because human cells do not produce any type of fluorescent proteins. Tissue culture plates and tissue culture plates coated with poly-D-lysine will be seeded with the same stock of HEK293T cells. The cells will be grown and handled under the exact same conditions and will differ only in the addition of a poly-d-lysine coating. While growing, the cells will be observed via microscope to observe any difference in the appearance of the cell membrane or other growth characteristics. Once the cells have grown enough they will be treated with mRNA delivered by the common transfection reagent lipofectamine. The transfection efficiency will be determined using the Thermo Fisher Countess automated cell counter. It has the ability to count the total number of cells and the number of cells expressing the green fluorescent protein. Given as a percentage this represents the transfection efficiency. Mean transfection efficiency of coated wells will be compared to the non-coated wells via an appropriate statistical test.
Michelle Glasscock
Suicidal Behaviors, ACEs, and Educational Attainment: A Potential Basis for Developing More Effective Assessment Tools for Education Professionals
The brain undergoes rapid development during childhood. Experience, both positive and negative, plays an important role in this process. When children experience abuse and/or neglect, it can interfere with their ability to be successful in school. This puts them at risk of not reaching their full potential academically, limiting occupational choices, and ultimately, earning potential. Research has also shown correlations with numerous harmful effects in adulthood (e.g., physical and mental health problems; CDC, 2019) as well as increased risk of suicide and substance abuse (Park, et al., 2021; Whitesell, et al., 2009). Again, the impact to quality of life can be devastating when these children reach adulthood. Therefore, early identification and intervention is crucial. Currently, K-12 schools use the Adverse Childhood Experiences (ACEs) questionnaire as a screener to identify students at risk for poor academic achievement (Catterfeld, 2019; NEA; Pataky, et al., 2019). However, this is only one area of concern related to child maltreatment. Childrens suicidal behaviors and initial use of substances often begin before reaching adulthood (CDC, 2019; HHS; 2019). This raises the question of whether the use of the ACEs should be expanded to screen for risk of suicide and substance use to provide a more comprehensive intervention plan. However, a few issues need to be explored. First, the relationship between ACEs and suicide have been investigated with an emphasis on suicide attempts and completions but not suicidal behaviors. Second, a similar research focus exists between educational attainment and suicidal behaviors (i.e., educational attainment has been linked to suicide attempts/completions but not behaviors). Therefore, the purpose of this research is to establish a link between suicidal behaviors, ACEs, and educational attainment that would permit earlier identification of risk before a suicide attempt or completion occur and/or educational attainment is threatened. To explore this question, a sample of 150 adult participants recruited through Prolific will be assessed for ACEs, suicidal behaviors, educational attainment, and substance misuse. Childhood maltreatment will be measured using the ACEs, suicidal behaviors will be examined with the Suicidal Behaviors Questionnaire Revised (SBQ-R), a question will ask participants what their highest level of education, and the NIDA-Modified ASSIST (NM ASSIST) will be used to characterize substance misuse. If a correlation is found between these variables, it would lend support to expanding the ACEs screener to include suicidal behaviors, giving educational professionals better tools with which to help students succeed.
Olivia Hohman
The Bioremediation of Polyethylene, Polyurethane, Polypropylene and Polystyrene by Aspergillus Niger and Bacillus Subtilis
As the manufacturing and consumption of plastics has continued to increase over the years, plastic debris poses a huge threat to many ecosystems. The amount of plastic accumulating in the environment has been steadily increasing as a result of plastic durability and lightweight nature (1). An estimated 300 million tons of plastic are produced and used yearly (1). Plastics are man-made materials manufactured from polymers or long chains of repeating molecules derived from oil, natural gas, and plants such as corn and sugarcane. In addition to replacing steel in cars, and wood in furniture, plastics have replaced paper and other cellulose-based products for packaging. Biodegradation of these abundant plastics may be the key to controlling this problem (1). A more efficient technique of plastic degradation may be achieved, by understanding the mechanism of polymer degradation. This requires researchers become familiar with how compounds are metabolized by existing organisms, as well as identifying new organisms capable of biodegradation and characterizing their metabolic abilities (2). Biodegradation is a complex natural process to decompose substances and involves several steps: 1) fragmentation of materials into smaller functions (bio-deterioration); 2) secretion of free enzymes and free radical species to cleave oligomers, dimers and monomers (depolymerization), 3) recognitions and reorganization of select molecules (assimilation), and 4) oxidation of simple molecules, and salts from metabolites (mineralization) (3). While a number of bacteria have been found to be excellent at biodegradation relatively few fungi have been identified as capable of plastic decomposition. Polyethylene, polyurethane, and polystyrene are the predominant types of plastics used in industry and manufacturing, and all have shown susceptibility to biodegradation (2). Plastics are polymers generated by the condensation of polyisocyanate resulting in a carbon polymer composed of urethane linkages (2). Alterations in the spacing between urethane linkages, as well at the substitutions, can change the properties of the resulting polymer from linear and rigid to branched and flexible (2). Microorganisms in prolonged contact with plastic wastes have been found to adapt and maximize their degradation potential (4). These microorganisms are reported to produce some special enzymes viz. intracellular and extracellular, which enable the microbes to disintegrate the polymer into several monomers and dimers, which are being used by the microbes as a carbon source (7). In this study, special interest will be paid to Aspergillus niger, and Bacillus subtilis for their ability as known degraders. Baseline growth and bioremediation potential of these organisms both on their own and in consortia will be observed against a variety of plastic substrates (polyethylene, polyurethane, polypropylene, and polystyrene). Activity of the microorganisms against the plastic substrates will be observed in the laboratory setting. Understanding the detailed metabolism of the organisms which naturally degrade plastics may shed light on the challenges of removing plastic waste to preserve our environment. Growth Establishment A 6mL starter culture of Bacillus subtilis will be prepared using nutrient broth and placed in the shaking incubator for 24 hrs at 30 and 220 rpm. 100 弮L of the starter culture will be spread on a nutrient agar plate and incubated for 24 hrs at 30 . Two single colonies will then be picked from the plate and a separate glycerol stock will be made for each colony. Aspergillus niger will be rehydrated using 6 mL sterile distilled water and allowed to sit for 24hrs. 100弮L of the starter culture will be spread on a Sabouraud Dextrose Agar (SDA) along with 100mg/mL ampicillin plate and incubated at 37 until growth is observed, 2 weeks, for fungi (2.3.5). Two single colonies will then be picked from the plate and a separate glycerol stock will be made for each colony. Bioremediation Tests Sheets of polyethylene and polyurethane, and shavings of polypropylene and polystyrene will be rinsed with sterile water, dried, weighed and sterilized with 70% Ethanol (4). Establishment of baseline bioremediation properties will be done with nutrient broth for Bacillus subtilis and Sabouraud Dextrose broth with ampicillin for Aspergillus niger. 1g of polyethylene, polyurethane, polypropylene or polystyrene will be added to the culture and growth will be carried out at 30 for Bacillus subtilis and 37 for Aspergillus niger for up to six weeks. The plastic sheet or shavings will be removed, cleaned with 70% ethanol and deionized water, dried in the oven for one hour, and weighted every 2 weeks. Once weighted the sheet or shavings will be added back to the culture. From there the degradation can be measured by the weight reduction of the dry samples. Three replicates will be done of polyethylene, polyurethane, polypropylene, and polystyrene with Aspergillus Niger, and Bacillus Subtilis. In addition to the negative control, which will contain only ampicillin in synthetic media, a positive control which contains each type of plastic with ampicillin in synthetic media will be prepared. The controls should show no fungal or bacterial growth and no weight reduction due to degradation. Bioremediation by fungi will be carried out in synthetic Czapek Dox broth (pH 6.8, 100 mg/mL ampicillin) (6). Bioremediation by bacteria will be carried out in Davis broth, a minimal ingredient medium (6). 1g of polyethylene, polyurethane, polypropylene or polystyrene will be added to the culture and growth will be carried out at 30 for Bacillus subtilis and 37 for Aspergillus niger for up to six weeks. The plastic sheet or shavings will be removed, cleaned with 70% ethanol and deionized water, dried in the oven for one hour, and weighted every 2 weeks. Once weighted the sheet or shavings will be added back to the culture. From there the degradation can be measured by the weight reduction of the dry samples. Three replicates will be done of polyethylene, polyurethane, polypropylene, and polystyrene with Aspergillus Niger, and Bacillus Subtilis. In addition to the negative control, which will contain only ampicillin in synthetic media, a positive control which contains each type of plastic with ampicillin in synthetic media will be prepared. The controls should show no fungal or bacterial growth and no weight reduction due to degradation.
Michael Hillary
Comparing Litter Decomposition Across a Gradient of Wetland Health
Background: Coastal wetlands are a vital part of the Great Lakes (Uzarki et al. 2019), by providing habitat, nutrients, fisheries and biodiversity to the ecosystem (Wetzel 1992, Brazner et al. 2000 and Wei et al. 2004). Many species rely on these wetlands for crucial nursery habitat, such as the yellow perch (Parker et al. 2012). In addition to benefiting the ecosystem, coastal wetlands have been estimated to produce 69 billion USD annually to the economy surrounding the Great Lakes (Krantzberg et al. 2008). In the past 100 years, human activities have caused a depletion of wetland habitat by over 50% (Krieger et al 1992) and these activities continue to threaten the remaining wetlands (Trebitz et al. 2007). For the past decade, the US EPAs Great Lakes monitoring program has been assessing wetland health. The monitoring program has based its categories of wetland health largely on what species can or cannot be found there (Uzarki et al. 2019). This only accounts for the structure of the wetland and doesnt represent the entire workings of its ecosystem. A functional indicator can aid in determining how it is working or how healthy it is based on its function (Sandin et al. 2009). One common way to test an ecosystems functional health, is to measure the rate of plant decomposition (Young et al. 2008, Udy et al. 2006 and Lamberti et al. 2017) because this function is affected by water quality and bacterial communities. Objective: The objective of my senior research is to assess whether current categories of wetland health correspond with the ecosystems functional health. This will be done using decomposition across a gradient of wetland health. As an alternative measurement, the number of bacteria feeding on the plant matter will be assessed. I hypothesize that the rate of litter decomposition will be quicker in higher quality wetlands compared to lower quality, and that microbial respiration will be higher in high quality wetlands compared to low quality. Overview of Methods: Litter decomposition will be measured in 12 wetlands during the summer, with 3 categories of health: high, medium and low across the St. Marys River, located in the Eastern Upper Peninsula of Michigan. Health categories will be determined using values assigned by the Great Lakes Coastal Wetland Monitoring program based on macroinvertebrates and fishes. Cattails will be used as the plant material as it is commonly found in the coastal wetlands. At least 156 mesh bags will be constructed from 1.27 mm mesh sheets: 20 x 20 cm (Benfield 1996), and each site will contain 13 bags. Ten grams of dried cattail will be weighed and placed in each mesh bag (Lamberti et al. 2017). Bags will be labelled with plastic tags, sealed with a vacuum sealer and tied onto rebar using braided fishing line. (Anderson et al. 2002). Six retrieval periods will take place every few weeks before the water freezes over. Three more retrieval periods will be completed after the ice melts next spring. Once mesh bags are retrieved, they will be dried, weighed, ashed, and re-weighed to determine loss of organic material (i.e., decomposition). The rate of mass loss over time will be used to calculate decomposition rate. On the 6th retrieval, the bacterial community on the plant material will be measured for each wetland. This will be done by measuring the rises and drops in oxygen during periods of light and dark incubation. During the light, photosynthesis will occur, and oxygen levels rise. During the dark, respiration will occur, and oxygen levels fall. Incubation will take place in Ashmun Bay to regulate temperature and sunlight the following morning of retrieval. Dark totes will be placed over light totes and then litter bags will be placed within the totes. This will allow the bags to be exposed to light and dark conditions without moving the bags. One of the tote sets will not contain any mesh bags and will serve as a control of microbial respiration without the litter. DO (dissolved oxygen) loggers will be placed in each shoe box tote to measure DO changes every 30 minutes. Changes in dissolved oxygen during the dark period and light period will be used to calculate respiration rates for each treatment. An ANCOVA test will be used to differentiate the loss of mass among wetland types over time. The mass loss would be the dependent variable, wetland type is the independent variable, and time is the covariate. The bacterial community gross primary production (GPP) will be calculated adding the oxygen change during the dark (R) by the oxygen change during the light (NPP). Respiration differences across wetland type and time will also be tested using an ANCOVA.
Paxton Spencer
Macroalgae in Saltwater Aquaponic Systems Reduce Nutrients in Effluent
Saltwater aquaponics is a relatively new area of study as a majority of systems are freshwater. However with growing concern over the lack of freshwater in many countries this setup is becoming the new way to farm in an effort to conserve drinking water and bring food to these areas. Aquaponics is known to conserve over 90% of water and be the sustainable way to raise two food sources that work together. However, effluent from these systems can cause eutrophication in watersheds as well as increase the salinity of the soil when not properly handled. Recent publications as of this year began to look at IMTAs or integrated multi-trophic aquaculture systems as a model in reducing the nutrient load of effluent. The idea of this system is to have three layers from a primary producer all the way to a primary consumer in an effort to reduce the solids into workable energy for macroalgae. IMTA systems have been studied in open ocean settings where they have found that the waste within the round-pens significantly decreased compared to pens without. They also found that the macroalgae grew much faster in this setting than it did on its own in similar growth pens without fish. Therefore, taking this multi-level system to land based shrimp farms could solve their excess nutrient effluent problem while in turn creating multiple avenues for business. To represent the aquaponic system set up each aquarium will have Salicornia europaea, a plant that will aid in nutrient testing as well. These species of plants do not like excess nutrients and have found to grow when there was not an abundance of phosphate or nitrogen in the water. Therefore, their growth rate will be another test outside of basic chemistry testing to see how much nutrients are in the water. This halophyte, or salt marsh plant, is just as much of a delicacy as nori seaweed is in the culinary world. Overall, finding that macroalgae can reduce nutrients in saltwater aquaponic systems there will be possibilities of expanding the field and reducing effluent waste.
Reyanna Rutledge
Prevalence of Caspase -9 Mutations in the Lung Cancer Population of the Eastern Upper Peninsula
Cancer is known for being the leading cause of deaths worldwide annually. While being the second most common diagnosed cancer, lung cancer is the leading cause of deaths worldwide (Mayo Clinic, 2021). Lung cancer is a type of abnormal cell growth that occurs in the lungs. To put into perspective, almost ten million cancer patients died in 2020, while nearly two million of those deaths were caused by lung cancer (Sung, H., et al., 2021). Therefore, identifying different causes to lung cancer should be prioritized. Today we know there are vast amounts of carcinogens in the world. Carcinogens are environmental factors that cause cancer. One example of this would be cigarettes. In fact, smoking is the best-known cause of lung cancer. On the other hand, lung cancer can also occur in patients who have never smoked. This leads to more background research such as; genetic history and other environmental factors to identify causes. Cancer is the development of tumors caused by rapid, uncontrolled proliferation of cells in the body. What causes these cells to rapidly proliferate? The development of cancer, is considered a multiple step process at the cellular level (Cooper, 1970). Mutations are the first step leading into any cancer development. These mutations affect cell division by altering how many proteins are present and their function of regulating how the cells grow, divide and how the protein repairs DNA (Gale, 2020). Once the mutation alters the DNA, continual replication of the altered DNA will occur. This can lead to mass cell division of the abnormal cells causing tumors. One type of mutation causes a proto-oncogene to convert to an oncogene. Proto-oncogenes promote cell growth and the differentiation of cells. This can be viewed as cell activity. When a proto-oncogene is mutated into an oncogene it can be over-active leading to excessive cell proliferation (Gale, 2020). Another type of mutation causes inactivation of tumor suppressor genes. The healthy tumor suppressor genes are part of the cellular balance that promotes apoptosis and inhibits cell division. Balancing the cells growth and death maintains a healthy body. The alteration of apoptosis caused by oncogenes and mutated tumor suppressor genes is the focus of this study. Apoptosis is programmed cell death, and the alterations to apoptosis are highly recognized in affects to human cancers (Olsson and Zhivotovsky, 2011). This form of cell death is controlled by caspases and other regulatory factors. There are a series of caspase genes, ordered by number and categorized into groups based off function. The focus of this study will be towards group II, since it is responsible for apoptosis. Group II is then split into two classes: initiator (apical) caspases (caspase-2, -8, -9 and -10) and effector (executioner) caspases (caspase-3, -6 and 7) (Olsson and Zhivotovsky, 2011). In short, the initiator caspase sends off an enzyme that signals the effector caspase to target specific proteins of the unhealthy cell to initiate apoptosis. To specify for this research, the focus will be on the initiator caspase, caspase-9, and polymorphisms or gene alterations that occur to it. There are several polymorphisms or mutations that occur in the caspase genes. Alterations of the caspase genes have been correlated to causing multiple types of cancer as well as lung cancer. Therefore, finding specific mutations linked to specific cancers is difficult. In studies specified to caspase-9 gene alterations, there is a lot of research on polymorphisms rs4645978 and rs4645981 and their link to lung cancer. A few studies have shown a possible correlation, more specifically of the rs4645981 polymorphism to lung cancer. For example, one study suggests a possible correlation to the development of lung cancer (Park, J., et al., 2006). In another study, three polymorphisms of different caspase genes were looked at, and were associated to with the risk of lung cancer (Lee, S.Y., et al., 2010). The possible link between the caspase-9 polymorphisms and lung cancer, could be steps toward finding the other causes of lung cancer. Therefore, the focus of this research will be on finding more data of polymorphisms on the caspase-9 gene in a population that could possibly be correlated to lung cancer. Methods: This study will be concentrated to the Eastern Upper Peninsula population, with participation of twenty lung cancer patients and twenty non-lung cancer patients as the control. Lung cancer patients will be identified by War Memorial Hospital Oncology department, and asked if they are interested in participating in the study. A waiver will be given to each participant, explaining the study and noting that identity of participants will not be traced from DNA sample. Each signed waiver will have a code number that matches with the number on a given swab, to keep identities anonymous. The participants will swab the inside of their cheek and place swab back into wrapping, for later testing. The swabs will then be taken to the 勛圖厙 lab where DNA extraction and amplification via PCR will take place. DNA amplification of the caspase-9 gene will be performed, using polymerase chain reaction (PCR). PCR using specific primers to make copies of targeted regions of the subject DNA. Each cycle doubles the amount of DNA copied. After 25-30 cycles there could be @ one billion copies. This can be repeated for several duplications of the same segment (National Human Genome Research Institute, 2020). Following previous studies, the PCR products will be sent out to Psomagen Inc. to sequence the DNA, to look at several mutations instead of just the two mentioned (Lee, S.Y., et al., 2010). Due to pricing, sending samples to be sequenced is considered the best option for analysis. After the DNA sequencing is completed, the base sequence can be analyzed. Each group will be analyzed through a paired T test. This will compare the prevalence of rs4645978 and rs4645981 that occurred in the control group to the prevalence in the lung cancer patients. Once the prevalence can be compared, the total mutation occurrence can be calculated for the population studied in the Eastern Upper Peninsula.
Hannah Brood/Team AMORE
勛圖厙 RobotX
The purpose of this research project is to design and develop an Unmanned Surface Vehicle (USV) mobile robot that is capable of completing the autonomous tasks specified by the 2022 Maritime RobotX Challenge. This competition is open to undergraduate and graduate student teams and will be held in Sydney, New South Wales, Australia. In order to complete these required tasks, the USV will need to be able to autonomously identify and localize different maritime objects, follow paths, hold positions, and communicate data to land stations and another mobile robot. The USV must also be able to correct itself in the presence of wind and waves. The RobotX competition directly advances the field of autonomous maritime operations since these task requirements are active research topics in fields such as ocean engineering and maritime mobile robotics. This is important since oceans and seas are highly dynamic environments that account for 71 percent of the Earths surface area. Advancing maritime autonomy will ultimately lead to better mapping of Earths oceans, improved data collection, and development of autonomous passenger and freight transportation. In order to complete this project, a Wave Adaptive Modular Vessel (WAM-V) has been granted to 勛圖厙 Robotics to serve as the base platform for the USV. The WAM-V is a 16-foot long, catamaran-style vessel with a payload capacity of 485 pounds. To meet the project requirements, the WAM-V will need propulsion, remote control, emergency stop, communication, power, vision, acoustic, and guidance, navigation, and control (GNC) systems. The propulsion system is used to move the vessel and will consist of motors and steering mechanisms. The remote control, emergency stop, and communication systems are used to manually control and shut down the vessel. The power system will consist of on-board batteries that will provide power to the other systems of the vessel. The vision and acoustic systems will use technology such as LiDAR, cameras, and hydrophones to provide information about the surrounding environment to the USV, allowing it to make decisions on how it should behave. The GNC system will consist of a computer that runs control software and a programmable circuit board that sends signals to the other systems of the USV. This research project is a School of Engineering and Technology Senior Design Project for Team AMORE (Autonomous Maritime Operations and Robotics Engineering). Team AMORE has six members. The faculty advisor for the team is Dr. Edoardo Sarda. As a nontechnical requirement for the project, Team AMORE has created the 勛圖厙 RobotX Club. This project will give both team and club members the opportunity to be involved in a multidisciplinary mobile robotics project that involves marketing, working with industry professionals, collaborating with international university students, and competing in an international competition.
Catherine Quon
Competition Between Lactobacillus Acidophilus and Staphylococcus Aureus in Egg Salad at 27 Degrees C
Staphylococcus aureus is the bacteria responsible for 41% of food poisoning outbreaks (Hernndez-Cortez et al. 2017). In the United States, there are approximately 241,000 cases of Staphylococcal food poisoning annually (Kadariya 2014). S. aureus is a concern as it is tolerant of high salt and sugar concentrations and produces heat resistant toxins (Kataoka et al. 2015, Hu et al. 2018). One to six hours after ingestion of the toxin causes symptoms including vomiting, diarrhea, fever, and cramping (Asao, 2002, Hu et al. 2007, Kim et al. 2011). Potlucks and picnic foods are at risk for S. aureus contamination as they are left at ambient temperature for hours, promoting the growth of bacteria. 30% of the human population carry S. aureus on their bodies and can spread the bacteria through physical contact and respiratory droplets (Argud穩n et al. 2010, Asao et al. 2003, Kim et al. 2011). Egg salad is a classic picnic food that is susceptible to S. aureus contamination. Competitive microbial growth between Lactobacillus acidophilus and Staphylococcus aureus may affect the growth of colonies. Lactobacillus produces hydrogen peroxide and lactic acid which has been shown to suppress the growth of S. aureus (Dahiya and Speck 1968, Sameshima et al. 1998). As L. acidophilus is commonly found in yogurts, it can be easily incorporated into the egg salad recipe. The objective is to determine the effect of Lactobacillus acidophilus on the growth of Staphylococcus aureus colonies in egg salad at 27簞C. Tryptic Soy Broth, Nutrient Agar, Lactobacilli MRS broth, and Lactobacilli MRS agar will be prepared according to the manufacturers instructions. S. aureus ATCC 43300 will be obtained from 勛圖厙 frozen bacterial stock. The L. acidophilus from the probiotic capsule will be suspended in broth. Gram staining will be done to confirm the identity of the bacteria after streaking for isolated colonies. The egg salad will be prepared according to the recipe. The sample batch of egg salad will be inoculated with both S. aureus and L. acidophilus. The control batch of egg salad will only be inoculated with S. aureus. The two batches will be incubated at 27 簞C for six hours to imitate a summer picnic in Sault Ste. Marie. Three sample replicates will be taken from both batches every hour and spread on an agar plate, then incubated for 24 hours. S. aureus colonies on each plate will be identified and counted. The mean and standard deviation will be taken for each of the three replicates. A scatterplot graph for Average CFU S. aureus/g vs. time incubated (hrs) will be made to compare the control to the sample (with L. acidophilus). Standard deviation error bars will be included on the graph for each time point. T-tests will be taken at each time point to determine if the difference in number of colonies of S. aureus per gram of egg salad is significant enough to say that L. acidophilus had an effect. Argud穩n, M.A., M.C. Mendoza and M.R. Rodicio. 2010. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2010(2): 1751-1773. Asao, T., Y. Kumeda, T. Kawai, T. Shibata, H. Oda, K. Haruki, H. Nakazawa and S. Kozaki. 2002. An extensive outbreak of staphylococcal food poisoning due to low-fat milk in Japan: estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiology and Infection 130(1): 33-40. Dahiya, R.S. and M.L. Speck. 1968. Hydrogen Peroxide Formation by Lactobacilli and Its Effect on Staphylococcus aureus. Journal of Dairy Science 51(10): 1568-1572. Hernndez-Cortez, C. I. Galma-Mart穩nez, L.U. Gonzalez-Avila, A. Guerror-Mandujano, R.C. Sol穩s and G. Castro-Excarpulli. 2017. Food Poisoning Caused by Bacteria (Food Toxins). Pages 33-72 in Poisoning From Specific Toxic Agents to Novel Rapid and Simplified Techniques for Analysis. N. Malangu (Editor). Intech Open. Hu., D.-L., G. Zhu, F. Mori, K. Omoe, M. Okada, K. Wakabayashi, S. Kaneko, K. Shinagawa and A. Nakane. 2007. Staphylococcal enterotoxin induces emesis through increasing serotonin release in intestine and it is downregulated by cannabinoid receptor 1. Cellular Microbiology 9(9): 2267-2277. Hu, J., L. Lin, M. Chen and W. Yan. 2018. Modeling for Predicting the Time to Detection of Staphylococcal Enterotoxin A in Cooked Chicken Product. Frontiers in Microbiology. 9 (1536): 1-11. Kadariya, J., T.C. Smith and D. Thapaliya. 2014. Staphylococcus aureus and Staphylococcal Food-Borne Disease: An Ongoing Challenge in Public Health. BioMed Research International 2014 (827965): 1-9. Kataoka, A., E. Enache, C. Napier, M. Hayman and L. Wedding. 2016. Effect of Storage Temperature on the Outgrowth and Toxin Production of Staphylococcus aureus in Freeze-Thawed Precooked Tuna Meat. Journal of Food Protection 79(4): 620-627. Kim, N.H., A.-R. Yun and M.S. Rhee. 2011. Prevalence and classification of toxigenic Staphylococcus aureus isolated from refrigerated ready-to-eat foods (sushi, kimbab and California rolls) in Korea. Journal of Applied Microbiology 111: 1456-1464. Sameshima, T., C. Magome, K. Takeshita, K. Arihara, M. Itoh, and Y. Kondo. 1998. Effect of intestinal Lactobacillus starter cultures on the behaviour of Staphylococcus aureus in fermented sausage. International Journal of Food Microbiology 41 (1998): 1-7.
Katja Wilhelms
Comparing the Effects of Traditional and E-Cigarette Vapor on Candida Albicans Growth and Virulence Factor Expression
Candida albicans is a prevalent and possibly pathogenic yeast found on most human bodies (Kendrick, 2017). While it typically acts as an interdependent fungus that causes the body no harm, an overgrowth of C. albicans may lead to infection and serious diseases known as candidiasis. As defined by the Center for Disease Control (CDC), candidiasis, also known as oral thrush, is an infection in the oral cavity caused by a Candida species. Symptoms include white patches on the inner cheeks, tongue, roof of the mouth and throat, redness or soreness, loss of taste, and pain while eating or swallowing (CDC, 2021). C. albicans and other Candida species are present in the oral cavity of up to 75% of the population (Ruhnke, 2002). Furthermore, a high incidence of C. albicans has been found in hospital settings. It was the most frequently isolated fungal pathogen (59.7%) in hospital environments (Beck-Sague and Jarvis, 1993). C. albicans has many different factors which increase the degree by which it can cause disease, making it more pathogenic that other Candida species. These factors include its attachment style, ability to change form, antifungal drug resistance, ability to congregate, and its secretion of aspartyl proteinase (Sap). This prevalence and widespread makes the study of C. albicans an important focus in the biomedical field. This research project aims to further explore the secretion of aspartyl proteinase (Sap) as an increased pathogenic factor in C. albicans. Sap is an extracellular enzyme that contributes to the nutrient acquisition, invasion, tissue damage, evasion of host response of C. albicans (Naglik, 2003). For example, the secreted proteinase from C. albicans decreases the antimicrobial defense efficacy of human saliva (Kaminishi, 1995), making C. albicans tough to kill in the oral cavity. Specifically, the SAP2 gene is one of the most commonly expressed genes in patients with oral candidiasis. The introduction of traditional cigarettes in the 1960s fueled a rise in the smoking of tobacco. However, as time passed, more and more research offered evidence on the harmful long-term health effects of cigarette smoking. It has been linked to multiple neurological, cardiovascular, and pulmonary diseases, as well as health problems such as asthma due to second-hand smoke in children (Das, 2003). While there has been a downward trend in their use, in 2019 the CDC estimated 14.0% (34.1 million) of U.S. adults were current cigarette smokers. Recently, electronic cigarettes (e-cigarettes), also known as vapes, have increased in popularity. They are proposed as a safer alternative to smoking, leading to an e-cigarette acceptability increase by the public (Camenga and Tindle, 2018). Like cigarettes, e-cigarettes have turned into a huge market able to sustain many different product brands. When comparing traditional and e-cigarettes, the key differences is the use of tobacco. Traditional cigarettes contain tobacco while e-cigarettes typically do not. This is one of the primary reasons why they are considered healthier. Nonetheless, both products still contain nicotine. Nicotine is the primary addictive ingredient in e-cigarette solutions and tobacco products (Walley, 2019). Non-scientific claims are creating confusion in the publics perception of the health of e-cigarettes. They are in fact hazardous to human health. Their use can cause multiple symptoms in the respiratory, nervous, gastro-intestinal system, etc. (Meo and Asiri, 2014). Yet, according to the U.S. Food and Drug Administration (FDA), 3.6 million youth still continue to use e-cigarettes today. Previous research has determined the effects that cigarette smoke vapor has on C. albicans. These findings are that cigarette smoke condensate promoted C. albicans growth and SAP2 enzymatic activity (Semlali, 2014). Because both methods of cigarette smoking are still widely used today, more research needs to be done to contribute to public health knowledge. The objective of this study is to compare the effects of traditional and e-cigarette smoke vapor on the growth rate and SAP2 gene expression of C. albicans. We hope to relate these findings to the risk of oral candidiasis with otherwise healthy smokers who contain C. albicans in their oral cavity. To perform this experiment, an in house smoking device (Baboni, 2009) will be used to collect cigarette smoke condensate (CSC) for a traditional cigarette group treatment. A 5% nicotine Juul pod liquid will be used for the e-cigarette group treatment. A Gas Chromatography Mass Spectrometry (GCMS) analysis will be performed to measure the amount of trace level nicotine in both treatment liquids to ensure equal amounts. A layer of the CSC and the Juul pod liquid will then be applied to 10 yeast peptone dextrose (YPD) agar plates each. A control group with no additive treatment will also be included. C. albicans will be suspended into a separate YPD broth to ensure ~200 colony forming units (CFU)/mL. 1 mL of this suspension will then be spread onto the surface of the plates and incubated at 37簞C to maintain its yeast form. Two plates from each group will be tested at 12 hrs., 24 hrs., 36 hrs., 48 hrs., and 60 hrs. after inoculation. This test will include counting the number of colonies for a growth assessment and running a reverse transcriptase qualitative polymerase chain reaction (rt-qPCR) assessment. The mean number of colonies will be calculated for each group. The growth rates will then be calculated using the equation: Rate = change in number of colonies / time . These results will then be placed into a line graph for clarity. The procedure for the rt-qPCR will be imitated from a similar study performed by Humidah Alanazi, Abdelhabib Semlali, Witold Chmielewski, and Mahmoud Rouabhia in 2019. Firstly, RNA will be extracted and converted into single-stranded cDNA using a purchased High-Capacity cDNA Reverse transcription Kit. The reactions will be prepared by combining the sample RNA with the 2X RT master mix (provided by the kit) and then placing them into the thermo cycler where the cycle conditions include: 10 minutes at 25簞C, followed by 120 minutes at 37簞C, 5 minutes at 85簞C, and then cooling to 4簞C. Next, these cDNA samples will be combined with purchased synthetic nucleotide primers (Table 1: SAP2), and a purchased SYBR Green Master mix in order to run the rt-qPCR. The rt-qPCR cycle conditions include: 5 minutes at 95簞C, followed by 30 cycles of 15 seconds at 95, 30 seconds at 60, and 30 seconds at 72簞C. Finally, the comparative Ct Method of rt-qPCR will be implemented to analyze these results. This method compares the differences between the SAP2 gene Ct values of each sample against a reference gene (Table 1: ACT1) that expresses at a uniform level. The mean of these differences will then be calculated for each group and compared using a one-way ANOVA test. Table 1. Primer Sequences Gene Primer Sequence (3-5) Tm(簞C) Amp Size (bp) SAP2 Forward: TCCTGATGTTAATGTTGATTGTCAAG Reverse: TGGATCATATGTCCCCTTTTGT 54 82 ACT1 Forward: GACAATTTCTCTTTCAGCACTAGTAGTGA Reverse: GCTGGTAGAGACTTGACCAACCA 57 87
Victoria Size
A Correlation Study of ACEs, BCEs, and ASD
Epigenetic factors play a role in gene expression in the offspring of affected parents. At present, no single environmental condition or genetic link has been found to produce humans with a diagnosis of Autism Spectrum Disorder (ASD). Results of this research will help future study efforts in determining the exact cause of ASD worldwide. This study will examine environmental conditions of parents during their childhood to determine whether there is a correlation between benevolent and adverse parental conditions and a diagnosis of ASD in offspring. It is known that there are genetic factors that can play a role in the development of ASD. To eliminate the element of genetic heritability as the cause of ASD, one questionnaire will be supplied which requests information on social personality preferences which would then screen parents for broad autism phenotype, which would signal a possible genetic inheritance as the cause for their childs development of Autism Additionally, participants will complete two more surveys which asks questions about negative experiences during childhood and positive experiences during childhood. This data will be coded and analyzed using statistical software SPSS to determine if there is an epigenetic link between parental childhood treatment and the production of atypically developing children. This epigenetic effect has already been studied and demonstrated using mouse models and fear conditioning.
Brandt Evans
Cannabinoids Potential as Antibiotics
The CDC lists antibiotic resistance as the number one global health threat in the world1. Certain bacteria such as methicillin-resistant Staphylococcus aureus (MRSA) responsible for various types of tissue infection in humans, Staphylococcus aureus (S. aureus) responsible for skin infections and Escherichia coli (E-coli), a bacteria that commonly causes urinary tract infections are growing increasingly resistant to current antibiotics. The CDC statistics show there are 2.8 million antibiotic resistant infections yearly, resulting in 35,000 deaths1. This is where cannabis cannabinoids could play a vital role as new antibiotics. Cannabinoids are secondary metabolites found in the cannabis sativa plant believed by many to have various medicinal properties. The human body contains an endocannabinoid system that works with cannabinoids to create numerous types of signals and triggers in the immune and nervous system of the body.
The proposed project is to test three cannabinoids, tetrahydrocannabinol (THC), cannabidiol (CBD) and cannabigerol (CBG) against MRSA, Staphylococcus aureus, and E-coli. The project will be performed using minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) assays. The MIC value will be a numerical representation of the concentration of cannabinoid required to inhibit the bacterias growth. The MBC will be calculated from the MIC achieved and represents the concentration of cannabinoid that causes approximately 99.9% bacterial death. These assays will combine an inoculated bacteria strain at a specific concentration and the cannabinoid at increasing concentrations in 96 well plates. The lower the MIC value the better and the closer the MBC to the MIC the better antimicrobial properties. The need to develop improved antibiotics is long overdue. In this research a goal would be to see all cannabinoids tested effective against both gram-negative (E-coli.) and gram-positive (MRSA, S. aureus) bacterial strains. This would provide evidence to warrant further research into these plants compounds as future antibiotics.
Simon Freeman
Larval Lake Whitefish/Zooplankton Density at Day and Night
Lake whitefish support some of the most commercially, culturally, and recreationally important fisheries in the Great Lakes. Lake whitefish populations have decreased since the 1990s in the upper Great Lakes, coinciding with the invasion of zebra and quagga (dreissenid) mussels (Pothoven et al. 2001). These invasive mussels have decreased phytoplankton, and subsequently, zooplankton populations (Pothoven and Madenjian 2008). Adequate amounts of zooplankton are critical for the growth and survival of larval fish (Zorn et al. 2020), including lake whitefish, who spend this time in shallow, beach habitats.
One hypothesis for decreased lake whitefish populations in the Great Lakes is a result of decreased zooplankton populations. However, limited data exist that examine zooplankton and larval lake whitefish relations, and existing data are only from daytime beach surveys. Habitat use by zooplankton and fish can vary significantly at day versus night, necessitating day and night comparisons to determine whether daytime sampling is adequate for quantifying lake whitefish-zooplankton relations (Doubek et al. 2020). To address these knowledge gaps, I ask: 1) What is the relationship between larval LAW and zooplankton prey density in Lakes Michigan, Huron, and Superior?, and 2) Does the relationship differ at night? To expand our knowledge on the relations between zooplankton and larval lake whitefish populations, I will work with 勛圖厙 and the Sault Tribe of Chippewa Indians to sample zooplankton, larval lake whitefish, and environmental data (water temperature, pH etc.) at 3 locations in each of the following: Lake Michigan, Lake Huron, and Lake Superior. My sampling will occur between April-June in the Eastern UP. In addition to this, I am receiving samples from multiple tribal, state, and federal agencies throughout the Great Lakes region (Green Bay, Muskegon, Duluth etc.). All samples will be processed by myself in the lab at 勛圖厙, and I will run statistical analyses.
Mackenzie Kalchik
The Effects of Diaphragmatic Breathing on Melatonin and Sleep Among Collegiate Student-Athletes
Along with the many responsibilities the average college student experiences, collegiate student-athletes have additional time-consuming responsibilities. These additional responsibilities include practices, competitions, travel, team meetings, and more. The stressors of academics and athletics have proven to have a large impact on the well-being of student-athletes, with almost half of male student-athletes and more than half of female student-athletes reporting that stress from athletics and academics has impacted their mental or emotional health (Humphrey, Yow, and Bowden, 2000). With the high prevalence of stress among student-athletes, it is common to lead to other negative impacts on the body. Chronic stress can lead to a decrease in quantity and quality of sleep (Soffer-Dudek and Shahar, 2011). Insufficient sleep has many consequences to the body, including the weakening of the immune system and a decrease in performance of the hypothalamus, pituitary, and adrenal glands, which leads to further consequences of a decline in physical performance and learning ability (Ghorbani at al., 2019). Melatonin is the main hormone synthesized by the pineal gland that is controlled by the hypothalamus and plays a role in regulating sleep-wake cycles by releasing low levels during the day, and the highest levels at night to prepare the body for sleep (Jennum et al., 2016). Because stress can impact the performance of the hypothalamus, therefore impacting the secretion of melatonin, circadian rhythm can be disrupted, consequently interfering with sufficient sleep in those affected. Due to the damages that stress and lack of sleep can have on an athletes performance in the classroom and in competition, it is imperative to give athletes a technique they can utilize on and off the field of play. Diaphragmatic breathing (DB) is a technique used by many yoga and meditation practices that involves breathing deeply into the lungs by expanding the diaphragm instead of the rib cage (Martarelli et al., 2009).
This breathing technique utilizes techniques that strengthen the diaphragm, decrease the work of breathing by slowing respiration rate, and decrease oxygen demand (Cleveland Clinic, 2018). Diaphragmatic breathing exercises have proven to be a non-invasive treatment that positively impacts insomnia, cardiac autonomic function, depression, and anxiety, all of which could improve the mental and physical health of an athlete (Ghorbani et al., 2019). Not only does diaphragmatic breathing improve these important aspects of athlete health, but it also has been proven to reduce testing stress and increase testing performance of the general college student population (Paul, Elam, and Verhulst, 2007). The purpose of this experiment is to investigate the impact of diaphragmatic breathing exercises on sleep in the collegiate student-athlete population by testing and observing melatonin levels. Participants will be given a five-minute diaphragmatic breathing exercise and asked to perform it every day for a period of two weeks. Melatonin levels will be collected once before they begin the diaphragmatic breathing exercises, and again after the two weeks of completing the exercises. It is hypothesized that sleep quantity and quality will improve among the student-athletes performing the breathing exercises and will be reflected in the increase of melatonin levels. Methods: A group of twenty-four student-athletes at 勛圖厙 will be asked to volunteer in this study. They will be given instructions on the diaphragmatic breathing exercises they will be asked to perform, and written consent will be obtained. There will be a control group of twelve students-athletes that will not perform diaphragmatic breathing exercises, and an experimental group of twelve student-athletes that will perform the breathing exercises. Data will be collected in two ways, which will consist of a survey and measurements of melatonin levels that will be completed before and after the study.
Each participant will be assigned a numerical code to maintain confidentiality of the participants. The experimental group will be shown a five-minute diaphragmatic breathing exercise they can find in any mobile App Store called, Strategic Breathing, that was created by Max Strom, an author and teacher with many accolades regarding his work with diaphragmatic breathing (Strom, 2021). The exercise within the app includes visual and audio instructions. The experimental group will be asked to perform the breathing exercise 30 minutes before bed every night for the two-week period in their own residency (Chander, 2020). The control group will not be asked to perform the breathing exercises and to continue on with their daily habits. The survey that will be conducted will ask a series of questions that will be beneficial to determine the effectiveness of the breathing exercises from a subjective point of view within the participants. Adapted from Assessment of Recovery after Scheduled Time off to Hospital Employees Working Night Shift, questions will be asked about sleep quality, sleep quantity, athletic performance, academic performance, and levels of stress participants experience. (Blyly & Ranson Olson, 2018). These surveys will be given before and after the study to each participant in both the control and experimental group. To measure melatonin levels, a melatonin saliva ELISA Assay kit will be used. Saliva will be collected by unstimulated passive drool. Participants will be asked to not eat 60 minutes before sample collection, as well as to avoid consuming alcohol 12 hours prior to sample collection. To analyze the data, a t-test will be used to observe the changes in melatonin levels within each individual from the beginning of the two-week experiment compared to the end. Another t-test will be conducted to test the average effect between the experimental and control groups. An ANOVA will be performed to determine any significant differences. If there is a significant difference that supports the hypothesis that diaphragmatic breathing increases melatonin levels, therefore improving sleep, the results will be presented to coaching staffs throughout the athletic department at 勛圖厙. If implemented, diaphragmatic breathing could be a beneficial tool for student-athletes to improve their physical and mental health. Literature Cited Blyly, McKenna, B. Ranson Olson. 2018. Assessment of Recovery after Scheduled Time off to Hospital Employees Working Night Shift. Chander, T. , Lakeview Internal Medicine, personal communication. Cleveland Clinic. 2021. Diaphragmatic breathing exercises & techniques.
Bobbi Jo Caskey
Impact of Plant Species on the Microbial Community of an Aquaponic System
Aquaculture, Hydroponics, and Aquaponics Aquaculture is the term used to describe the breeding, raising, and harvesting of living organisms in an aquatic environment (US Department of Commerce, 2019). Fish farming is often a common term. A common example of this is recirculating aquaculture system (RAS). While systems may vary, the concept remains the same. The water that holds the fish circulates out along with any waste or leftover food. It is then brought through a filtration, then an aeration unit that will return oxygen to the water and remove carbon dioxide (Losordo, et. al., 1999). Fish are not the only organism that can be raised as algae, seaweed, and other aquatic plants can also be grown. Hydroponics is a similar concept, however terrestrial plants are produced. It includes growing crops in water rather than soil (Tripp, 2014). Fertilizers, including vitamin and minerals are added to the water to ensure the plants have what is needed for growth. While both hydroponics and aquaponics provide significant advantages, specifically when addressing overconsumption of our food supply, recent studies have shown that a combination of the two could provide an even greater benefit (Junge et al., 2017). Aquaponics, not to be confused with aquaculture, integrates the recirculation of water and aeration of a RAS but uses the terrestrial plants and nitrifying bacteria from hydroponics to rid the system of waste products harmful to the fish. The fish will produce nitrogen waste in the form of ammonia. This ammonia is then broken down into nitrite and then nitrate by the microbes. A buildup of ammonia or nitrite can be harmful to the fish however nitrate is relatively harmless. Nitrate is also the preferred source of nitrogen for plants (Rakocy, et al., n.d). In the end the plant, fish, and bacteria all benefit. Microbes in the System While all components of the system are important, this study will look specifically at the microorganisms. Hydroponics, like aquaponics, often use nitrifying bacteria to produce nitrate, so it can be assumed that the microbiota will be similar, however it is unclear on how the aquaculture aspect will affect these microbes. It is not unlikely to find plant growth-promoting rhizobacteria (PGPR) in a hydroponic system. Rhizobacteria are the bacteria that grow directly on the edges of the roots. This means that they have direct contact with the roots. They maintain a symbiotic relationship and help promote plant growth accomplishing one of the following: reducing nitrogen into nitrate, enhancing stress resistance, stabilizing phosphate and potassium intake (Cakmakci, Donmez, and Erdoan, 2007). While they are extremely common in soil, PGPRs are also used as a biofertilizer to help plant growth in both hydroponics and soil grown crops. It was specifically found that Bacillus spp. Gliocladium spp., Trichoderma spp., and Pseudomonas spp. were common bacteria and can be found in a healthy hydroponic system (Lee, and Lee, 2015). All the previous species are also considered Rhizobacteria. Each species benefits the plant differently. For example, one distinction of Bacillus spp is that some species lowered the infection rate of some pathogens (Nihorimbere et al., 2011). In addition, specific species were reported to increase water quality and growth rate (Nihorimbere et al., 2011). Some species of Pseudomonas spp. were shown to decrease root rot and have some antifungal properties on certain species (McCullagh, et al., 1996). Now turning the attention to the aquaculture side, one study found that two main types of bacteria were found: autotrophic and heterotrophic bacteria. Many autotrophic bacteria were ammonia oxidizers such as Nitrosococcus, Nitrosospira, and Nitrosomonas or nitrate oxidizers such as Nitrobacter and Nitrospira (Rurangwa and Verdegem, 2015). These oxidizers help reduce the amount of ammonia and nitrite (that are harmful to the fish) into nitrate or nitrogen gas that are much less toxic. The heterotrophic bacteria were found to be different depending on the species of fish. For example one study using carp found Alphaproteobacteria and Betaproteobacteria. Later the same group used goldfish instead and found a larger variety of microbes that included Actinobacteria, Bacilli, Gammaproteobacteria, Planctomycetacia, Sphingobacteria, Hyphomicrobium denitrificans, Rhodovulum euryhalinum and Nitrospira moscoviensis (Sugita, et al., 2005). Advantages of Aquaponics/Implications and Relevance Food security is becoming an increasingly relevant topic globally. The United Nations Food and Agriculture Organization (FAO) estimated that by 2050, the global population will reach 9.1 billion and our agricultural system allone will not be able to supply enough food (Sohngen, 2017). In addition, studies have shown a great decline in labor in agriculture (Christiaensen, Rutledge, and Taylor, 2020). Finally, as the amount of people going into agriculture decreases, it was also found that those going into the agricultural sector have less knowledge than previous generations (Kuiper, Shutes, Van Mejil, et al., 2019). Without the proper knowledge and understanding, a series of trial and errors will occur that could have been prevented. Now that we are aware of the problem, it is now time to come up with a solution. Aquaponics, as previously mentioned, recirculation of water along with the aeration of a RAS but uses the terrestrial plants and nitrifying bacteria from hydroponics to rid the system waste products harmful to the fish. The end result would be both a supply of fish and produce grown from the plants. Aquaponics also has a multitude of other benefits. Some agricultural policies such as pesticides, fertilizers, and over use of soil have shown negative effects on the environment (Goudie and Viles, 2003). Aquaponics recirculates the water and only produces organic waste that is easily broken down (Konig, et al., 2016). This makes aquaponics an eco-friendly solution. As well as being an environmentally friendly solution, it is also economically friendly. The largest cost of maintaining an aquaponic system in a commercial style system was fish food (Konig, et al., 2016). The aeration unit, bacteria, and plants contribute to make the water reusable for the fish meaning the cost of water significantly decreases. Finally, aquaponic brings forth the idea of having a local food source rather than having dependence on food being brought in. This dependence can be seen currently in the pandemic. Studies have shown that because of travel restrictions, some consumers are no longer able to visit their typical spot nor were their typical products available (Laguna, et. al, 2020). It is also predicted to see an 17 million increase in food insecure Americans in 2020 compared to 2018 (Gundersen, et al., 2020). If used accordingly aquaponics could help reduce the dependence on transported goods. Aquaponics could be one part of solving the problem of food insecurity. It has shown to have great promise in multiple aspects economically, environmentally, and even more so in food sustainability. However, its full potential cannot be reached without a thorough understanding of the system. Abundant research has been done on the microbial ecosystem of hydroponics and aquaculture, but little has been done in aquaponics. Traditional aquaculture does not typically look into the microbes of the system. One of the main reasons being that DNA sequencing is very expensive to be proforme. In 2015, it was estimated that a whole human genome sequence would cost approximately $4,000 (Wetterstrand, 2020). This study will contribute to the knowledge on the microbial ecosystem. The objective of this study is to identify common microbes of an aquaponic system and to see if the type of plant has any effect on the microbes within the systems. The hypothesis is that while there are some microbes that are predicted to be the same, there will be a significant difference between the systems with different types of plants. Methods: Overview of setup Seven (7) five-gallon tanks will be used in this study. 3 tanks will have plant A (most likely basil), and 3 tanks will have plant B (most likely swiss chard). The remaining 2 tanks will be a control and hold additional fish respectively. These fish will be used as a replacement if one of the fish in the trial system passes on. All tanks will be cleaned with 20% bleach and thoroughly washed out with deionized water. They will then be air dried for 7 days to ensure that any left over chlorine is degraded. The figure below depicts a larger version of the system that will be implemented in this study. It will use a cylindrical tubing cut to look like a C to hold the plants grown in rock wool. A submersible water pump will be used to force water into the tubing. The tubing will be held at an angle to allow water to flow back into the tank. To speed up the growth of bacteria, nitrifying bacteria will be added as an additive (this is common in aquaculture). Three goldfish will be placed in each trial tank along with the control. The fish will be fed 1.2 grams of food. Measurements of temperature, ammonia, nitrite, nitrite, pH, chlorine, water hardness, and dissolved oxygen will be taken every Monday, Wednesday, and Friday before the addition of food to the system. This will be done to record and understand the health of the system while the microbiota is being established. This system will be allowed to run for 45-60 days. After the allotted time, microbial samples will be collected, and analyzed. This system was designed by a group of New Jersey students for the Lunar Plant Growth Challenge put on by NASA. Image Credit: Atlantic County Institute of Technology (Smith, 2009) Microbial Analysis In order to identify the microbes, the following procedure will be performed. A sample of water from each tank will be collected in a sterilized beaker. During transportation a clean tin foil cover will be used to prevent contamination. The samples will then be immediately filtered using a filter membrane with .45 micrometer pores. This is large enough to catch any organism, yet still be able to filter out any waste. The DNA will then be extracted from the filter by using an Illustra Bacteria GenomicPrep Mini Spin Kit. Once extracted, PCR will then be used along with a 16s microbiome kit that will help enrich and amplify the bacterial DNA. After this, DNA Clean & Concentrator Kits, Zymo Research will then be used to purify the bacteria and ensure that any leftover material from the PCR. Finally, DNA sequencing will be able to be performed and the data will then be analyzed to identify the species of microbes Data Analysis Once the microbes are identified, a series of two group t-tests will be performed. Since the data will not be numbers, some modifications will have to be made. To begin, each system with plant A will be paired with a system form with plant B. In all there will be 3 pairs. Then, all the found microbes will be placed on a spreadsheet. At this point, the microbes will be translated into 1 or 0 depending if the microbe was found in the system (1), or not found in the system (0). Each pair will then have a two group T-test run on them to see if there is any significant difference between the two. After the calculations are completed, confidence intervals will be used and a conclusion will be made. Timeline: Fall 2020: (current) prepare proposal, research, trial systems, present proposal Spring 2021: continue trial research (determining if this is the setup I want to us), practice maintaining system (to ensure less problem during experimentation) Summer 2021: Work and earn money for project Fall 2021: Perform project, gather and organize data, begin analyzing results Spring 2022: take Bio 499, begin final report, senior presentation Budget: Fish: .25$ each $2 6 in one test strips: 100 for 15$ $15 Submersible water pumps with tubing $84 5-gallon tank 8 x 10 $80 DNA Clean & Concentrator Kits, Zymo Research present in lab 16s Microbial DNA prep kit present in lab PCR reagents $~50 ZymoBiomics DNA miniprep kit $274 Extraction filter present in lab Various glassware present in lab PCR machine present in lab Plastic petri dishes (40) $22 Nutrient Agar powder $46.30 Flow cell-NGS Nanopore $100 Overall price: $673.30 Any suggestions would be extremely beneficial, and I thank you for your time. Literature Cited: Cakmakci, R. Donmez, M. and Erdoan, . 2007. The Effect of Plant Growth Promoting Rhizobacteria on Barley Seedling Growth, Nutrient Uptake, Some Soil Properties, and Bacterial Counts. Turkish Journal of Agriculture and Forestry 31:189-199. Christiaensen, L. Rutledge, Z. and Taylor, J. E. 2020) Viewpoint: The future of work in agri-food. Food Policy, 101963. Goudie, A. and Viles, H. 2003. The earth transformed: An introduction to human impacts on the environment. John Wiley & Sons, New Jersey, USA Gundersen, C. Hake, M. Dewey, A. et al. 2020. Food Insecurity during COVID 19. Applied Economic Perspectives and Policy 00, 00: 1-9 Junge, R. K繹nig, B. Villarroel, M. Komives, T. et al. 2017. Strategic Points in Aquaponics. Water. MDPI. 9(3): 10.3390/w9030182. Konig, B. Junge, R. Bittsanszky, A. et al. 2016. On the sustainability of aquaponics. Ecocycles 2(1), 26-32. Kuiper, M. Shutes, L. Van Mejil, H. et al. 2019. Labor supply assumptions A missing link in food security projections. Global Food Security 25. Laguna, L. Fiszman, S. Puerta, P. et al. 2020. The impact of COVID-19 lockdown on food priorities. Results from a preliminary study using social media and an online survey with Spanish consumers. Food Quality and Preference 86, 104028. Lee, S. and Lee, J. 2015. Beneficial bacteria and fungi in hydroponic systems: Types and characteristics of hydroponic food production methods. Scientia Horticulture 195: 206-215. Losordo, T. Masser, M. and Rakocy, J. 1999. Recirculating Aquaculture Tank Production Systems A Review of Component Options. SRAC Publication No. 453. McCullagh, M. Utkhede, R. Menzies, J.G. et al. 1996. Evaluation of plant growth-promoting rhizobacteria for biological control of pythium root rot of cucumbers grown in rockwool and effects on yield. Eur J Plant Pathol 102: 747755. Nihorimbere, V. Cawoy, H. Seyer, A. et al. 2011. Impact of rhizosphere factors on cyclic lipopeptide signature from the plant beneficial strain Bacillus amyloliquefaciensS499. FEMS Microbiology Ecology 79(1): 176-191. Rakocy, J. Masser, M. and Losordo, T. (n.d). Recirculating Aquaculture Tank Production Systems: AquaponicsIntegrating Fish and Plant Culture. SRAC-454. Rurangwa, E. and Verdegem, M. C. 2015. Microorganisms in recirculating aquaculture systems and their management. Reviews in Aquaculture 7(2): 117-130. Smith, H. 2009. Aquaponics. Retrieved November 01, 2020 from Sohngen, T. 2017. The World May Run Out of Food in the Next Decade: Study. Retrieved October 15, 2020 . Sugita, H. Nakamura, H. and Shimada, T. 2005. Microbial communities associated with filter materials in recirculating aquaculture systems of freshwater fish. Aquaculture 243(1-4): 403-409. Tripp, T. 2014. Hydroponics advantages and disadvantages. Pros and Cons of Having a Hydroponic Garden. Speedy Publishing LLC, Delaware, USA. US Department of Commerce. 2019. What is aquaculture? Retrieved October 06, 2020 from Wetterstrand, K. 2020. The Cost of Sequencing a Human Genome. Retrieved November 10, 2020.
Rachel Farina
Immunoglobulin Specificity Testing of Salmonid Species Using Rabbit, Rat, and Chicken Antiserum
Immunoglobulin specificity testing of salmonid species using rabbit, rat, and chicken antiserum Rachel Farina 勛圖厙 School of Science and Medicine Dr. Jun Li Fall 2020 Introduction In the Great Lakes region, several species of salmonid fish are naturally common in the wild and in hatcheries for research, breeding, and human consumption: lake trout (Salvelinus namaycush), rainbow trout (Oncorhynchus mykiss), brown trout (Salmo trutta), and atlantic salmon (Salmo salar). Immunological fish health is a very important topic discussed, especially in places where fishing is a main industry. Since these species of fish live in such large numbered communities, pathogens can spread rather quickly. Large amounts of disease, illness, and death in fish can economically harm the fishing industry greatly and reduce a common source of food for the human population living in this area (Magnadottir, 2010). As the fish industry increases, the immune system of these salmonid species must be studied fully, and laboratory reagents and practices must be developed further. Most organisms have an immune system, and fish are the first group of organisms with both innate and adaptive immunity (Magnadottir, 2010). The immune system of any organism is composed of many different types of cells and proteins that protect the organism from pathogenic threats. The salmonid immune system depends on the innate immune system heavily for health, much more than adaptive immunity (Uribe, 2011). Complement, a series of soluble proteins, and neutrophils, cells with phagocytic capabilities, are some of the main innate defenses that are present in fish mucosal membranes to fight off and kill pathogenic organisms. The innate system does not have any long-term memory functions, but it can fight off any pathogens very quickly without needing specific antigen interactions (Ma, 2020). Usually, an organism gets infected with a pathogen and is never aware because the innate immune system kills the pathogen before it can become symptomatic, and thus the adaptive immune system is never activated. Salmonids do also have an adaptive immunological response that is long lasting, but slow to activate. Fish have B-lymphocytes and T-lymphocytes both, but no lymph nodes for all the cells to congregate and accelerate the production of antibodies (Magnadottir, 2010). A single antibody is a Y-shaped molecule with variable regions that allows different molecules to interact with a very specific antigen. B-cells in fish secrete antibodies in response to specific antigens from potential pathogens. Then, the antibodies find the antigens in the body and attach to them so other immune cells know what to attack (Owen et al., 2009). It is important to note, especially in the Great Lakes area, that the secretion of antibodies is temperature-dependent and the activity is lowered in cold temperatures (Dixon). IgM antibodies are the most present isotype in salmonids, but they are tetrameters, four Y-shaped units attached together, instead of pentameters, five Y-shaped units attached together. The pentameter IgM is found in humans and mammals (Magadan, 2016). The adaptive immune system needs to be activated by the innate system, so an organism would only produce antibodies to something that the innate immune system could not handle by itself. The adaptive immune system contains a memory system which prevents the fish from getting sick from the same pathogen twice and a faster immune response to familiar pathogens (Owen et al., 2009). Because of this, even healthy fish contain antibodies in their serum. Enzyme Linked Immunoassay Assay (ELISA) testing is a major technique in immunological laboratories. It tests for the presence of a specific antigen or antibody by using the opposite as a reagent. Antibodies are very specific and match with only one antigen with great specificity. The original serum and a known laboratory reagent are mixed together into a well and allowed to incubate so the antigen and the antibodies can bind together. In some cases, a secondary detection antibody is necessary, which is a[n] antibody that binds a primary antibody that is not enzyme-conjugated (Alhajj, 2020). This is the indirect ELISA test. Then, a color changing substrate is added, usually horseradish peroxidase (HRP), so the wells can be analyzed in a plate reader (Owen et al., 2009). The concentration of antibodies detected can be determined from a created standard curve using the absorbance readings. Antiglobulin testing is a procedure used in microbiological, virological, and immunological laboratories. It is used to detect the presence of antibodies in one species by using the antiserum of another species. Purified antibodies from the original serum that is being analyzed are injected into a secondary species, where the animals immune system creates antibodies against the purified antibodies that were injected (Harmening, 2019). These antibodies can be used as the secondary detection antibodies in an indirect ELISA test (Alhajj, 2020). This can be used to detect the presence of a specific antibody in a laboratory setting and the minimum dilution that detects the antibodies. In this specific study, IgM antibodies were purified from the salmonid species, and anti-fishIgM IgG antibodies were created for the rabbit and rat, and anti-fishIgM IgY antibodies were created for the chicken. This study will test the specificity of each antibody-antiglobulin reaction between the four salmonid species and the three different antiglobulin producing species. Serum already collected from each fish species will be used for all specimens, and all of the antiserum is already created and is stored. These samples are from previous staff and students of 勛圖厙. The study will determine which antisera works best to detect IgM antibodies for each salmonid species and the minimum dilution at which they are detected. Methods and Analysis The detection method to determine the specificity of each combination of specimen and antiserum will be done by ELISA testing. The salmonid IgM antibodies will be introduced into a well plate, and incubated for 15 minutes at room temperature to allow them to coat the walls of each well. Then, the different antisera secondary antibodies will be introduced to the wells, and allowed to incubate for 15 minutes at 37 degrees Celsius. Last, substrate will be added to each well, incubated at room temperature for 5 minutes, and observed for color change results. In between each step, the wells will be washed with 1x PBS three times to ensure accurate results. The plates will be spectrophotometrically analyzed by a plate reader at a 450 nm to test for specificity (Alhajj, 2020). I will use 96-well plates for analysis. Row A and B will contain control materials, with fetal bovine serum (FBS) as a negative control and Rainbow Trout serum as a positive control. The other columns will be replicates of each fish serum-antisera combination. Each has a series of dilutions, repeated four times: 1:500, 1:1000, 1:2000, 1:4000, 1:8000, 1:16000. This setup can be seen below in Figure 1. The goal of this, is not only to see which antisera can detect the fish antibodies, but also to see the minimum concentration needed for detection. Creating laboratory antisera and isolating the antibodies for clinical use are both time consuming and expensive techniques. It is very resourceful to know what the minimum concentration needed is, so lab reagents can last longer and be used more. I plan to use an ANOVA test to determine if there are any significant differences to prove one antisera species binds more specifically to the fish antibodies than the others. Since there are two independent variables, a two-way ANOVA test will have to be performed. The specificity will be determined for all interactions, with two groups, or factors: fish serum species and antiserum species. There are four levels for the fish serum, and three levels for the antiserum species. This means that degrees of freedom is 3 for the fish serum and 2 for the antiserum species. Table 1: Treatment Groups Lake Trout Rainbow Trout Brown Trout Atlantic Salmon Rabbit Rat Chicken Each will have the exact same amount of replicates, four, and the averages determined by the plate reader will fill in the table listed above. A main effect test, interaction test, within variation test, and an F-test will be run using a two-way ANOVA test to determine significance of this study. If there are significant results, this project may develop farther. References Alhajj, M., Farhana, A. (2020). Enzyme Linked Immunosorbent Assay (ELISA). Statpearls. Dixon, B. The immune response in fish: A brief review. Received on 04 October 2020 fromHarmening, D.M. (2019). Modern Blood Banking & Transfusion Practices. F.A. Davis, p. 103-110. Ma, S. (2020). Effects of environmental stressors on the innate function of Atlantic Salmon (Salmo salar). Lake Superior State Senior Project. Magadan, S., Sunyer, O.J., Boudinot, P. (2016). Unique features of fish immune repertoires: particularities of adaptive immunity within the largest group of vertebrates. Results Probl Cell Differ. 57: 235264. Magnadottir, B. (2010). Immunological control of fish diseases. Marine biotechnology, 12, p. 361379. Owen, J., Punt, J., Stranford, S. (2009). Immunology. The Journal of Experimental Medicine, p. 660-663. Uribe, C., Folch, H., Enriquez, R., Moran, G. (2011). Innate and adaptive immunity in teleost fish: a review. Veterinarni Medicina, 56, (10): 486503.
Veronica Shull
Team Superior Acoustics and Geophysical Solutions: A Method of Oil Detection in Bodies of Water Covered by Ice
Team Superior Acoustics and Geophysical Solutions is a senior research group consisting of three Mechanical Engineering students: ________; and one Electrical Engineering student: ____. The students in this group have taken coursework in Acoustics, Signal Processing, Vibrations and Noise Control, Research Methods and Electromagnetics to prepare for the research to be pursued in this project. The team intends to perform experiments to test a method of oil detection in bodies of water covered by ice with the purpose of detecting and mapping oil spills to assist in expediting the clean up process. There is little research available in this area and due to the close proximity of 勛圖厙 to Enbridges Line 5, a 4.5 mile long pipeline carrying oil through the Straits of Mackinac, this issue is of greater interest to students at the university and the wider community. The proposed method involves hydroacoustics and uses reverberation time to detect changes from a pristine state. The hypothesis of the method states that the rate, at which a sound field decays changes, based on environmental factors, and the effects of oil on the sound field are measurable. Testing of the method by this team will be done in a scaled tank environment and efforts will be made to implement the method in a full-scale environment. The team will also improve the scaled tank environment by obtaining a material that would adequately represent the acoustic properties of ice without requiring the generation of natural ice, permitting testing to continue when the outdoor temperature isnt low enough for growing ice by exposure. An impulsive sound source will also be identified by this team to be used in both the scaled tank environment and in full-scale implementation. In order to mitigate issues encountered by future groups with full scale implementation, this team will also collect data from lake environments in order to analyze the ambient noise present to establish a sound floor and investigate potential passive sources. In lieu of using crude oil in a lake environment for testing, an acoustics software package will be obtained in order to perform calculations that will further validate the method. Documentation of decisions made, supporting research and processing code will be compiled for future students to continue validation and implementation of the method. This documentation will be presented at an academic conference and a paper will be published to contribute to the larger body of research in oil detection methods. The team has a budget of $1000 from the School of Engineering and Technology at 勛圖厙 which will be used to obtain materials to test as an ice substitute, research papers, make repairs to the small-scaled tank environment and make improvements on the current sound source used in the small-scale tank environment.
Carlie Weaver
The Effects of PFAS on the Beneficial Gut Bacteria Lactobacillus Acidophilus
Perfluoroalkyl substance (PFAS) contamination has recently become a large topic of discussion (and action) across the nation, specifically in the state of Michigan. These chemicals have incited executive orders, action response teams, and state-declared states of emergency (MPART, 2019). PFAS are long, fluorinated carbon chains that were commonly used in industry from the 1950s until discontinuation in the United States around 2015 as food packaging, nonstick coating, firefighting foam, and an important component of teflon. During these years, these chemicals have found their way into ground water sources, and from there into the human body (Buck et al., 2011). Water sources have been tested and have been found to have much higher concentrations of PFAS, particularly perfluorooctanoic acid (PFOA) and perfluorooctane sulfonic acid (PFOS), than is considered safe. Measurements of greater than 30,000 parts per trillion (ppt) have been found in groundwater despite the legal cap for safety being placed at a mere 70 ppt (Reade et al., 2019). Recently, the Center for Disease Control has named PFAS chemicals of concern toward human health, as research has shown that they may be one of the causes of numerous diseases, including cancer, diabetes, infertility, and weakened immune system. They may also contribute to changes in the liver, thyroid, pancreas, and more, as the chemicals have a long half-life in the body and are present in serum.(Anderson-Mahoney et al., 2008) (Center for Disease Control, 2018). While PFOA and PFOS have been discontinued in the US, a new chemical has taken its place. Named GenX, 2,3,3,3-tetrafluoro-2-(heptafluoropropoxy)propanoic acid is now being manufactured to compensate for the loss of PFOA and PFOS. This chemical has been advertised as safe, despite causing symptoms of disease in lab rats (Shea, 2018). The creator company, Chemours, has endorsed and produced the chemical. Recent tests show that GenX is also present in drinking water and accumulates in the blood (North Carolina Department of Environmental Quality). The exact mechanism of the diseases caused by PFAS is still unknown. Research has yet to disclose all of the effects these chemicals may have on the body, and how they are caused. One potential mechanism of disease may be through disruption of beneficial bacteria in the gut. The human body is known to have a large variety of flora, particularly consisting of a variety of bacteria, that have been shown to play a crucial role in human health, and damage to the microbiome has been linked to cancer, liver disease, diabetes, and more (Jandhyala et al., 2015) (Sekirov et al., 2010). Lactobacillus acidophilus is a species of bacteria found in the human gastrointestinal tract. This species has been shown to have major beneficial roles in human health: Lactobacillus has been shown to protect against liver disease, and increased numbers of the bacterium are also related to a lowered risk of colorectal cancer (Ritze et al., 2014) (Moore and Moore, 1995) (Guarner and Malagelada, 2003). Colorectal cancer is the third leading cause of cancer deaths in the United States, and is affecting ever increasing amounts of young people in the United States (Siegel, Jemal, and Ward, 2009). Because of this connection, killing these beneficial bacteria could be detrimental to the overall health of the US population (Zhong, Zhang, and Covas, 2014). Despite the small amounts of current literature on the subject, PFAS have been shown to disrupt the membrane bilayer of bacteria, and at high enough concentrations have been shown to damage and even kill the bacteria (Fitzgerald et al., 2018). Because PFAS are found in water, have been ingested by humans, and are even found in the blood, it is entirely possible that the presence of PFAS in the GI tract can interfere with or even kill bacteria in the gut, including the beneficial Lactobacillus. The death of Lactobacillus bacteria may thus be a causal factor in diseases such as colorectal cancer and liver disease. The purpose of this experiment is to investigate the relationship between PFAS and human health by determining the effect of PFAS on the beneficial bacteria of the gut. Three PFAS will be tested- the commonly found PFOA and PFOS, and the new GenX chemical. It is hypothesized that all PFAS tested, including the safe GenX, will have some inhibitory effects on Lactobacillus acidophilus, demonstrating a possible mechanism of disease in the human body. Methods: The effect of PFAS on Lactobacillus acidophilus was tested in two ways. One of these tests measured the zones of inhibition created by treating Lactobacillus acidophilus with multiple concentrations of PFAS. When a petri dish of bacteria is treated with a small disc covered in an inhibitory chemical and allowed to incubate, a circle of no bacterial growth will appear around the disc- this area is measured and is called a zone of inhibition. The larger a zone of inhibition is, the stronger the inhibitory effect was. The other test performed was a spectrophotometric assay that allowed for the growth of the bacteria to be measured. Each bacterial species has a characteristic growth curve that can be graphed when measuring absorbance of a bacterial sample over a long period of time. If the bacteria is treated with an inhibitory chemical, this characteristic growth curve will change. Escherichia coli was used as a control, as it has demonstrated sensitivity to PFAS in previous research. When compared, the data will show if Lactobacillus acidophilus may be even more sensitive to PFAS than E. coli. Zones of inhibition: 50 Petri dishes were inoculated with either Lactobacillus acidophilus or Eschericia coli. Diffusing discs were placed on the center of each plate, and each of the discs was treated with 40ul of either a high PFOA concentration, low PFOA concentration, high PFOS concentration, low PFOS concentration, high GenX concentration, low GenX concentration, or no PFAS at all. This was repeated in triplicate, so that 3 of each treatment group for each bacteria could be measured. These petri dishes were incubated at 37 degrees celsius for four nights, and any zones of inhibition were measured. Spectrophotometric assay: Six 50 mL tubes of liquid growth media were treated with either a high PFOA concentration, low PFOA concentration, high PFOS concentration, low PFOS concentration, high GenX concentration, or low GenX concentration. A 4 mL aliquot was removed from each of the larger stocks and transferred into a separate 5 mL test tube, for a total of 6 tubes. One additional tube of 4 mL untreated liquid growth media was also prepared. Into each of these tubes, 100 ul Lactobacillus acidophilus culture was placed. This process was repeated two more times, for triplicate measurements. The above procedure was followed, but instead of placing 100 ul Lactobacillus into the tubes, 50 ul E. coli was used instead, to allow for a control to compare Lactobacillus to. This created a total of 42 tubes. All 42 tubes were placed into a warm water bath at 37 degrees celsius, and shaken overnight. Beginning the next morning, the absorbance levels of the tubes were measured using a spectrophotometer at 660 nanometers wavelength. This was performed approximately each hour for 8 hours. The absorbance data was used to create a growth curve for the normal bacteria and each of the different PFAS groups. Data analysis: An ANOVA will be performed on the zone of inhibition data to determine which PFAS had the most effect, at what concentration, and which bacteria was most affected. The average growth curve for each treatment group will be plotted and compared to the normal growth curve to determine the effects of different concentrations of PFOA, PFOS, and Gen X on the bacteria over time.
Rebecca Weipert
Does Change in Location Affect the Frequency or Severity of Allergies?
The objective of my study is to determine whether there is a correlation between individuals that have moved locations from childhood and adulthood and have increased sensitivity to allergens. Allergies are caused by the immune systems response to allergens. Allergens are one type of antigen which promote antibody production in the body. Allergens promote a specific antibody to produce, Immunoglobin E (IgE) antibodies. In the presence of IgE antibodies, allergy symptoms occur. These allergy symptoms are also classified as Type I Hypersensitivity reactions. In this study, the allergens that are being focused on are substances that are both foreign and harmless to the body and cause symptoms of hay fever. Hay fever symptoms include any combination of the following: runny/stuffy nose, itchy/watery eyes, inflammation of airway, headache, fatigue and phlegm. The most common types of allergens to cause these symptoms are pollen, dust, mold and dander. Mast cells, basophils and eosinophils are all types of white blood cells that are activated from the production of IgE antibodies. Increased numbers of eosinophils correlate with the presence of allergies; therefore, you are able to count eosinophils in blood samples and detect the presence or absence of allergies. A study conducted in 2012 showed that children living in urban cities had a higher prevalence of allergic diseases than children who lived in rural towns and villages. The children living in the urban areas also reported that they had experienced more frequent and severe allergies than the children living in the rural areas. To conduct this study, a minimum of thirty 勛圖厙 student participants will be needed. The participants will be assigned into groups according to their childhood residences. Half of the participants will be in a group with their residence being Sault Ste. Marie (SSM) and currently reside there. The other half will be in another group with their childhood residences from a location other than SSM but live there currently. This groups childhood residences must not be within 115-mile radius of SSM. Questionnaires will be provided to each participant pertaining to past hometown information and frequency and/or severity of allergy symptoms since being in SSM. Finger pricks and HemoCue white blood cell analyzer will be carried out and used in order to obtain blood eosinophil counts in each participant.
Sydney Zuke
Examining the Correlation Between Variations of the ACTN3 Gene and Athletic Predisposition in Division II Student-Athletes at 勛圖厙
In the scientific community, it has been widely accepted that elite athletic performance is a result of a combination of environmental factors and genetic makeup (Georgiades, 2017). Although elite athletic performance is dependent upon many different genes, this research will examine a specific gene, alpha-actinin-3 (ACTN3), also known as the sprinter or speed gene, and its genotypes (Pickering & Kiely, 2017; Del Cosa et al., 2019). This gene is of particular interest because it encodes the alpha-actinin-3 protein which is responsible for generating fast-twitch muscle fibers. Fast-twitch muscle fibers are responsible for generating high amounts of force quickly. Therefore, the variant form of the ACTN3 gene is common in elite athletes that participate in sports that require explosive power, such as sprinting (Ostrander, Huson & Ostrander, 2019). The ACTN3 genotype will be examined to determine its presence in Division II student-athletes at 勛圖厙 in order to understand if those student-athletes were predisposed to athletic success because of the ACTN3 gene or if their success was determined primarily through effort. Thus, we are examining whether nature predisposes Division II athletes the same as witnessed in elite athletes, or if nurture and training play a larger role in success. This study will take samples from athletes of both anaerobic (power and speed) prevalent sport student-athletes and aerobic (endurance) prevalent sport student-athletes to determine the degree of prevalence of the ACTN3 genotype. The information will be used to determine if there is a correlation between sport type and the presence of the ACTN 3 genotype in this population. This will be accomplished through the collection of DNA samples through cheek swabbing and subsequent analysis. Norman et al. (2014) conducted similar methodology. Purpose Statement: The purpose of this research study is to determine if there is a significant correlation between the presence of ACTN3 genotype and athletic predisposition in Division II student-athletes at 勛圖厙. Relation to field of study: Nature, or genetic predisposition, has been proven to be a precursor to athletic success at the elite level (Pickering & Kiely, 2017) As the competition becomes stronger, the athlete must have nurtured their athletic talents, but they must also have similar genetic predispositions in order to truly compete (Ostrander, Huson & Ostrander, 2019). Thus, we see athletes selecting one sport to compete in at the elite level. This is not true at lower levels. At the high school level, it is common for athletes to play 2, 3 or even 4 sports (Bell et al., 2016). Some of these athletes may not play sports at the collegiate level. However, for those that do, they must rise to a new level of competition. It is not known if the level of competition at the Division II level is elite enough in which genetics must play a role in order for athletic success. Thus, this study adds to the field of kinesiology by beginning to answer the question regarding nature versus nurture at the Division II level of competition. The answer to this question has much to offer in terms of training methodology and recruitment of student-athletes. Methodology: Upon approval of the HSIRB committee, student-athletes who participate in Division II athletics at 勛圖厙 will be asked to participate on a volunteer basis. Following the informed consent process, student-athletes from anaerobic and aerobic based sports (tennis, basketball, volleyball, cross-country, track and field and golf) will be asked to set up a time for DNA collection through swabs. No procedures will be performed until informed consent is provided to the participants. Student-athletes will meet the primary and faculty researcher in the genetics lab and complete a short demographic survey to identify gender and sport. Numbers will be used in place of identifying information. Following the demographic survey, the primary researcher will conduct a cheek saliva DNA swab. Following the DNA swab, student-athlete participation in this study will be complete. The primary researcher will immediately prepare the swab for DNA analysis to determine the presence of the ACTN3 genotype.
Kassidy Hadix
I will be looking for the frequency of two common gene mutations in the Eastern Upper Peninsula Caucasian population. The genes of interest are Factor V (responsible for blood clotting) and methylenetetrahydrofolate reductase (MTHFR, which regulates homocysteine buildup). These mutations are important because they can lead to serious conditions, such as abnormal blood clots and miscarriages. DNA samples will be obtained from non-invasive cheek swabs; amplified using PCR and quantified using the new gene fragment analyzer in the School of Science and Medicine at 勛圖厙. We will compare the EUPs prevalence of these mutations to that of the overall U.S. population. Knowing the frequency of these two mutations can help to educate healthcare professionals and the general public about the risks associated with these conditions, so that people can better regulate their health.
Breanna Kemppainen
Chemical cleaners are used to clean surfaces in households, hospitals, and public places to protect us from illness. Most cleaners use a spray-then-wipe method but it is unclear how the physical action of wiping contributes to removing bacteria. Some cleaners may not be actually killing bacteria, but friction from wiping may be enough to physically remove them. In this study we will clarify the contribution that friction makes to cleaning surfaces by counting the number of bacteria removed from a surface when using dry materials versus the amount removed when using the same material wet with water or a cleaner.
Sophie McConkey
The intent of this research project is to enable a mobile robot to accept human assistance for the purpose of deviating from its autonomously generated path, thus reaching its desired destination, while avoiding obstructions. The results of this research will enable Automated Guided Vehicles to overcome the challenge of navigation within dynamic environments. The team plans to use a TurtleBot 3 Waffle Pi, equipped with a Color Sensor Distance Measuring Sensor, and Gyro Sensor, an 8 Megapixel camera, and a Nvidia Jetson TX2 computer board to accomplish this task.
Rebekka Ranta
Identifying and understanding the effect that perceived stress and resilience levels have on an individuals performance when presented with an acute-stress inducing task is very important. For university students, many are frequently faced with negative situations that are not always directly related to academics. By identifying such, the way an individual performs under pressure can be better understood. Participants were evaluated on their stress and resilience perceptions, their performance on the stress-inducing task, and their heart rate levels. Research surrounding this topic is of value because it provides information that could improve the health, well-being, and retention of university students.
George Schaffer
I am researching how lung function may influence symptoms of panic, such as shortness of breath, a racing heartbeat, feeling faint, or shaking. I measured lung function using a spirometer, a small handheld device that measures exhalation speed and lung capacity. I also asked participants to fill out a demographic survey and a panic survey detailing their history of panic attacks, the specific symptoms they had if theyd experienced a panic attack, and whether or not they had experienced a panic attack recently.
Brendan Lukomski
Comparing rhizospheric differences between young growth and old growth Eastern White Pine (Pinus strobus)
In this study the goal will be to determine differences in rhizospheric soil microbial communities between differing aged stands of Eastern White Pine (Pinus strobus). Soil samples have been collected at 3 locations; a site near Tahquamenon State Park, a location just southwest of Sault Ste. Marie, MI, and a site near Copper Harbor, MI. The extracted microbial DNA from the soil samples are then analyzed for microbial community abundance as well as diversity within the community. This will determine whether or not the Eastern white pine individuals are selecting certain microbial community characteristics throughout their lifetime.
Brianna Regan
The impacts of enrichment on the problem-solving abilities of rats (Rattus norvegicus)
The physical, psychological, and overall well-being of animals can be negatively impacted by captivity. Enrichment is a method of keeping captive species engaged by giving them activities to partake in throughout the day. Enrichment devices could include toys, novelty objects, food, sensory activities, and much more. My project will utilize rats to investigate the impacts enrichment can have on problem-solving ability. There will be a control and a treatment group. The rats in the control group will not be exposed to enrichment, while the rats in the treatment group will. Each rat will be evaluated by recording the time it takes them to complete a maze before and after the experiment takes place. This data will be analyzed to look for differences between the rats that were exposed to enrichment and the rats that were not to assess how problem-solving ability is impacted by enrichment.
Lucas Sheppard
Effects of salinity on serum cortisol in Atlantic salmon
This project will look into safe handling techniques of Atlantic salmon (Salmo salar) in regard to performing a Dip into a salt bath for vaccinations. Salmon will be randomly assigned into three salt test groups with a further level of variation being length of test. Blood was taken post different salinity exposure in order to determine a safe concentration of salt to use for a Dip as well as length of time. Total blood cell count and plasma cortisol levels were analyzed under microscope and via ELISA test respectively. ANOVA test was used for data analysis to find a difference between the tests: serum cortisol and salinity treatment
Victoria Size
The Effects of PFAS on the Development and Mitochondrial Function in Zebrafish Ova
Ren矇e Resendes of Windsor, ON tested the effects of PFAS (Per- and Polyfluoroalkyl Substances) on the development and mitochondrial function of zebrafish ova. The two most common forms of PFAS are PFOA and PFOS, which are persistent in the environment and of common exposure to humans. The study aimed to determine if there was a correlation between changes in embryonic development and energy production, as a result of exposure to PFOA, PFOS, and in combination. Her results showed that PFOA and PFOS in combination affected embryonic development, caused changes in energy regulation, and within these conditions even resulted in embryo death before 14 days old. Research of PFAS is of value because of the potential harm these chemicals have on reproductive and developmental processes and overall adverse human health effects.
Jessica Thompson
Stress levels related to Acetaminophen usage in social conformity
Recently, some newly found side effects of acetaminophen, the active ingredient in Tylenol, have shown suppressed emotional output. This study was designed to use social conformity as a medium to monitor any behavior, mood, or physical changes acetaminophen may have on those who consume it. A total of 48 participants were evaluated during a small group activity on their cortisol levels, mood states, blood pressure/pulse, and behavioral changes. The data gained will be analyzed to determine if acetaminophen is decreasing physiological stress reaction and mood changes, and if the suppression of stress may result in a behavioral change.